public void GetSubSubstring()
{
const string expectedResult = "CGTG";
var sequence = new SimpleSequence("GGTCACACGATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTAGATCACCCCC");
var observedResult = SequenceUtilities.GetSubSubstring(4, 10, true, 1, 4, sequence);
Assert.Equal(expectedResult, observedResult);
}
/// <summary>
/// get the genomic change that resulted from this variation [Sequence.pm:482 hgvs_variant_notation]
/// </summary>
private void GetGenomicChange(Transcript transcript, HgvsNotation hn, bool isGenomicDuplicate)
{
hn.Type = GenomicChange.Unknown;
// make sure our positions are defined
if (hn.Start.Position == null || hn.End.Position == null)
{
return;
}
int displayStart = (int)hn.Start.Position;
int displayEnd = (int)hn.End.Position;
// length of the reference allele. Negative lengths make no sense
int refLength = displayEnd - displayStart + 1;
if (refLength < 0)
{
refLength = 0;
}
// length of alternative allele
var altLength = hn.AlternateBases.Length;
// sanity check: make sure that the alleles are different
if (hn.ReferenceBases == hn.AlternateBases)
{
return;
}
// deletion
if (altLength == 0)
{
hn.Type = GenomicChange.Deletion;
return;
}
if (refLength == altLength)
{
// substitution
if (refLength == 1)
{
hn.Type = GenomicChange.Substitution;
return;
}
// inversion
var rcRefAllele = SequenceUtilities.GetReverseComplement(hn.ReferenceBases);
hn.Type = hn.AlternateBases == rcRefAllele ? GenomicChange.Inversion : GenomicChange.InDel;
return;
}
// If this is an insertion, we should check if the preceeding reference nucleotides
// match the insertion. In that case it should be annotated as a multiplication.
if (refLength == 0)
{
int prevPosition = displayEnd - altLength;
if (!isGenomicDuplicate && _compressedSequence != null && prevPosition >= 0)
{
// Get the same number of nucleotides preceding the insertion as the length of
// the insertion
var precedingBases = SequenceUtilities.GetSubSubstring(transcript.Start, transcript.End,
transcript.Gene.OnReverseStrand, prevPosition, prevPosition + altLength - 1, _compressedSequence);
if (precedingBases == hn.AlternateBases)
{
isGenomicDuplicate = true;
}
}
if (isGenomicDuplicate)
{
hn.Type = GenomicChange.Duplication;
// for duplication, the hgvs positions are deceremented by alt allele length
var incrementLength = altLength;
hn.Start.Position = displayStart - incrementLength;
hn.End.Position = hn.Start.Position + incrementLength - 1;
hn.AlleleMultiple = 2;
hn.ReferenceBases = hn.AlternateBases;
return;
}
// otherwise just an insertion
hn.Type = GenomicChange.Insertion;
hn.Start.Position = displayEnd;
hn.End.Position = displayStart;
return;
}
// Otherwise, the reference and allele are of different lengths. By default, this is
// a delins but we need to check if the alt allele is a multiplication of the reference.
// Check if the length of the alt allele is a multiple of the reference allele
if (altLength % refLength == 0)
{
hn.AlleleMultiple = altLength / refLength;
string multRefAllele = string.Concat(Enumerable.Repeat(hn.ReferenceBases, hn.AlleleMultiple));
if (hn.AlternateBases == multRefAllele)
{
hn.Type = hn.AlleleMultiple == 2 ? GenomicChange.Duplication : GenomicChange.Multiple;
return;
}
}
// deletion/insertion
hn.Type = GenomicChange.InDel;
}
