public string GetCdnaSequence()
{
if (_sequence != null)
{
return(_sequence);
}
var sb = StringBuilderCache.Acquire();
foreach (var region in _regions)
{
if (region.Type != TranscriptRegionType.Exon)
{
continue;
}
sb.Append(_compressedSequence.Substring(region.Start - 1, region.End - region.Start + 1));
}
if (_onReverseStrand)
{
string reverseComplement = SequenceUtilities.GetReverseComplement(sb.ToString());
sb.Clear();
sb.Append(reverseComplement);
}
ApplyRnaEdits(sb);
_sequence = StringBuilderCache.GetStringAndRelease(sb);
return(_sequence);
}
/// <summary>
/// Retrieves all Exon sequences and concats them together.
/// This includes 5' UTR + cDNA + 3' UTR [Transcript.pm:862 spliced_seq]
/// </summary>
private static string GetSplicedSequence(ISequence refSequence, ITranscriptRegion[] regions, bool onReverseStrand)
{
var sb = StringBuilderCache.Acquire();
foreach (var region in regions)
{
if (region.Type != TranscriptRegionType.Exon)
{
continue;
}
var exonLength = region.End - region.Start + 1;
// sanity check: handle the situation where no reference has been provided
if (refSequence == null)
{
sb.Append(new string('N', exonLength));
continue;
}
sb.Append(refSequence.Substring(region.Start - 1, exonLength));
}
var results = StringBuilderCache.GetStringAndRelease(sb);
return(onReverseStrand ? SequenceUtilities.GetReverseComplement(results) : results);
}
public static List <SequenceResult> GetVerificationResults(List <string> sequences)
{
List <SequenceResult> verificationResults = new List <SequenceResult>();
foreach (string sequenceAsString in sequences)
{
Sequence sequence = SequenceUtilities.GetSequenceFromString(sequenceAsString);
SequenceResult result = new SequenceResult(sequence);
int i = 0;
bool correspondingSequence = false;
while (i < sequence.PossiblePermutations.Count && !correspondingSequence)
{
string currentPermutation = sequence.PossiblePermutations[i];
Sequence serializedSequence = sequence.Serialize(currentPermutation);
if (serializedSequence.ReadsFrom.DictionaryEqual(sequence.ReadsFrom) &&
serializedSequence.FinalWrites.DictionaryEqual(sequence.FinalWrites))
{
correspondingSequence = true;
result.IsValid = true;
}
result.TestedPermutations.Add(serializedSequence, correspondingSequence);
i++;
}
verificationResults.Add(result);
}
return(verificationResults);
}
/// <summary>
/// constructor
/// </summary>
public HgvsCodingNomenclature(TranscriptAnnotation ta, Transcript transcript, VariantFeature variant,
ICompressedSequence compressedSequence, bool isGenomicDuplicate)
{
_ta = ta;
_transcript = transcript;
_variant = variant;
_compressedSequence = compressedSequence;
_isGenomicDuplicate = isGenomicDuplicate;
_sb = new StringBuilder();
// get reference sequence strand
var transcriptOnReverseStrand = transcript.Gene.OnReverseStrand;
// this may be different to the input one for insertions/deletions
var altAllele = ta.AlternateAllele;
string variationFeatureSequence = altAllele.AlternateAllele;
// get the reverse complement of the vfs if needed
if (transcriptOnReverseStrand)
{
variationFeatureSequence = SequenceUtilities.GetReverseComplement(variationFeatureSequence);
}
// calculate the reference start and end
GetReferenceCoordinates(transcript, altAllele, out _hgvsStart, out _hgvsEnd);
// decide event type from HGVS nomenclature
_hgvsNotation = new HgvsNotation(ta.TranscriptReferenceAllele, variationFeatureSequence,
FormatUtilities.CombineIdAndVersion(transcript.Id, transcript.Version), _hgvsStart, _hgvsEnd,
_transcript.Translation != null);
}
private static string GetRotatingBases(ISimpleVariant simpleVariant, bool onReverseStrand)
{
string rotatingBases = simpleVariant.Type == VariantType.insertion ? simpleVariant.AltAllele : simpleVariant.RefAllele;
rotatingBases = onReverseStrand ? SequenceUtilities.GetReverseComplement(rotatingBases) : rotatingBases;
return(rotatingBases);
}
public void GetSubSubstring()
{
const string expectedResult = "CGTG";
var sequence = new SimpleSequence("GGTCACACGATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTAGATCACCCCC");
var observedResult = SequenceUtilities.GetSubSubstring(4, 10, true, 1, 4, sequence);
Assert.Equal(expectedResult, observedResult);
}
public static string GetHgvscAnnotation(ITranscript transcript, ISimpleVariant variant, ISequence refSequence,
int regionStart, int regionEnd)
{
// sanity check: don't try to handle odd characters, make sure this is not a reference allele,
// and make sure that we have protein coordinates
if (variant.Type == VariantType.reference || SequenceUtilities.HasNonCanonicalBase(variant.AltAllele))
{
return(null);
}
var onReverseStrand = transcript.Gene.OnReverseStrand;
var refAllele = onReverseStrand ? SequenceUtilities.GetReverseComplement(variant.RefAllele) : variant.RefAllele;
var altAllele = onReverseStrand ? SequenceUtilities.GetReverseComplement(variant.AltAllele) : variant.AltAllele;
// decide event type from HGVS nomenclature
var genomicChange = GetGenomicChange(transcript, onReverseStrand, refSequence, variant);
var variantStart = variant.Start;
var variantEnd = variant.End;
if (genomicChange == GenomicChange.Duplication)
{
(variantStart, variantEnd, refAllele, regionStart, regionEnd) = transcript.TranscriptRegions.ShiftDuplication(variantStart, altAllele, onReverseStrand);
}
var startPositionOffset = HgvsUtilities.GetCdnaPositionOffset(transcript, variantStart, regionStart);
var endPositionOffset = variantStart == variantEnd
? startPositionOffset
: HgvsUtilities.GetCdnaPositionOffset(transcript, variantEnd, regionEnd);
if (onReverseStrand)
{
var tmp = startPositionOffset;
startPositionOffset = endPositionOffset;
endPositionOffset = tmp;
}
// sanity check: make sure we have coordinates
if (startPositionOffset == null || endPositionOffset == null)
{
return(null);
}
var transcriptLen = transcript.End - transcript.Start + 1;
//_hgvs notation past the transcript
if (startPositionOffset.Position > transcriptLen || endPositionOffset.Position > transcriptLen)
{
return(null);
}
var hgvsNotation = new HgvscNotation(refAllele, altAllele, transcript.Id.WithVersion, genomicChange,
startPositionOffset, endPositionOffset, transcript.Translation != null);
// generic formatting
return(hgvsNotation.ToString());
}
private static bool IsHgvspNull(string transcriptAltAllele, int cdsStart, int cdsEnd, ISimpleVariant variant,
string hgvscNotation)
{
return(string.IsNullOrEmpty(hgvscNotation) ||
variant.Type == VariantType.reference ||
SequenceUtilities.HasNonCanonicalBase(transcriptAltAllele) ||
cdsStart == -1 ||
cdsEnd == -1);
}
public static GenomicChange GetGenomicChange(IInterval interval, bool onReverseStrand, ISequence refSequence, ISimpleVariant variant)
{
// length of the reference allele. Negative lengths make no sense
int refLength = variant.End - variant.Start + 1;
if (refLength < 0)
{
refLength = 0;
}
// length of alternative allele
int altLength = variant.AltAllele.Length;
// sanity check: make sure that the alleles are different
if (variant.RefAllele == variant.AltAllele)
{
return(GenomicChange.Unknown);
}
// deletion
if (altLength == 0)
{
return(GenomicChange.Deletion);
}
if (refLength == altLength)
{
// substitution
if (refLength == 1)
{
return(GenomicChange.Substitution);
}
// inversion
string rcRefAllele = SequenceUtilities.GetReverseComplement(variant.RefAllele);
return(variant.AltAllele == rcRefAllele ? GenomicChange.Inversion : GenomicChange.DelIns);
}
// deletion/insertion
if (refLength != 0)
{
return(GenomicChange.DelIns);
}
// If this is an insertion, we should check if the preceding reference nucleotides
// match the insertion. In that case it should be annotated as a multiplication.
bool isGenomicDuplicate = HgvsUtilities.IsDuplicateWithinInterval(refSequence, variant, interval, onReverseStrand);
return(isGenomicDuplicate ? GenomicChange.Duplication : GenomicChange.Insertion);
}
public string GetCodingSequence()
{
var sb = StringBuilderCache.Acquire(Length);
// account for the exon phase (forward orientation)
if (_startExonPhase > 0 && !_geneOnReverseStrand)
{
sb.Append('N', _startExonPhase);
}
foreach (var region in _regions)
{
if (region.Type != TranscriptRegionType.Exon)
{
continue;
}
// handle exons that are entirely in the UTR
if (region.End < _codingRegion.Start || region.Start > _codingRegion.End)
{
continue;
}
int tempBegin = region.Start;
int tempEnd = region.End;
// trim the first and last exons
if (_codingRegion.Start >= tempBegin && _codingRegion.Start <= tempEnd)
{
tempBegin = _codingRegion.Start;
}
if (_codingRegion.End >= tempBegin && _codingRegion.End <= tempEnd)
{
tempEnd = _codingRegion.End;
}
sb.Append(_compressedSequence.Substring(tempBegin - 1, tempEnd - tempBegin + 1));
}
// account for the exon phase (reverse orientation)
if (_startExonPhase > 0 && _geneOnReverseStrand)
{
sb.Append('N', _startExonPhase);
}
var s = StringBuilderCache.GetStringAndRelease(sb);
return(_geneOnReverseStrand ? SequenceUtilities.GetReverseComplement(s) : s);
}
public void ThirdTest()
{
List <int> testSequence = new List <int>()
{
1, 1, 2, 5, 11, 4, 4
};
var actual = SequenceUtilities.GetLongestSubsequenceOfEqualNumbers(testSequence);
var expected = new List <int>()
{
1, 1
};
CollectionAssert.AreEqual(expected, actual);
}
private static void MapCdnaCoordinates(Transcript transcript, TranscriptAnnotation ta, VariantAlternateAllele altAllele)
{
if (transcript.Gene.OnReverseStrand)
{
ta.TranscriptReferenceAllele = SequenceUtilities.GetReverseComplement(altAllele.ReferenceAllele);
ta.TranscriptAlternateAllele = SequenceUtilities.GetReverseComplement(altAllele.AlternateAllele);
}
else
{
ta.TranscriptReferenceAllele = altAllele.ReferenceAllele;
ta.TranscriptAlternateAllele = altAllele.AlternateAllele;
}
CdnaMapper.MapCoordinates(altAllele.Start, altAllele.End, ta, transcript);
}
public void SecondTest()
{
List <int> testSequence = new List <int>()
{
5, 5, 5, 3, 2, 1, 4, 3, 5, 5
};
var actual = SequenceUtilities.GetLongestSubsequenceOfEqualNumbers(testSequence);
var expected = new List <int>()
{
5, 5, 5
};
CollectionAssert.AreEqual(expected, actual);
}
private static string GetDownstreamSeq(IInterval simpleVariant, IInterval rotateRegion,
ISequence refSequence, bool onReverseStrand, string rotatingBases)
{
int basesToEnd = onReverseStrand ? simpleVariant.Start - rotateRegion.Start : rotateRegion.End - simpleVariant.End;
int downStreamLength =
Math.Min(basesToEnd,
Math.Max(rotatingBases.Length,
MaxDownstreamLength)); // for large rotatingBases, we need to factor in its length but still make sure that we do not go past the end of transcript
string downStreamSeq = onReverseStrand
? SequenceUtilities.GetReverseComplement(
refSequence.Substring(simpleVariant.Start - 1 - downStreamLength, downStreamLength))
: refSequence.Substring(simpleVariant.End, downStreamLength);
return(downStreamSeq);
}
private long CollatzLengt(long n)
{
long len = 0;
var original = n;
while (n > 1)
{
if (_memory.TryGetValue(n, out long value))
{
return(len + value);
}
len++;
n = SequenceUtilities.Collatz(n);
}
len++;
_memory[original] = len;
return(len);
}
public string GetCodingSequence()
{
if (_sequence != null)
{
return(_sequence);
}
var sb = StringBuilderCache.Acquire(Length);
// account for the exon phase (forward orientation)
if (_startExonPhase > 0 && !_geneOnReverseStrand)
{
sb.Append('N', _startExonPhase);
}
foreach (var region in _regions)
{
// handle exons that are entirely in the UTR
if (region.Type != TranscriptRegionType.Exon || region.End < _codingRegion.Start || region.Start > _codingRegion.End)
{
continue;
}
AddCodingRegion(region, sb);
}
// account for the exon phase (reverse orientation)
if (_startExonPhase > 0 && _geneOnReverseStrand)
{
sb.Append('N', _startExonPhase);
}
if (_geneOnReverseStrand)
{
var revComp = SequenceUtilities.GetReverseComplement(sb.ToString());
sb.Clear();
sb.Append(revComp);
}
//RNA edits for transcripts on reverse strand come with reversed bases. So, no positional or base adjustment necessary
// ref: unit test with NM_031947.3, chr5:140682196-140683630
ApplyRnaEdits(sb);
_sequence = StringBuilderCache.GetStringAndRelease(sb);
return(_sequence);
}
/// <summary>
/// extracts the coding sequence corresponding to the listed exons
/// </summary>
public string Sequence()
{
_sb.Clear();
// account for the exon phase (forward orientation)
if (_startExonPhase > 0 && !_geneOnReverseStrand)
{
_sb.Append('N', _startExonPhase);
}
foreach (var map in _cdnaMaps)
{
// handle exons that are entirely in the UTR
if (map.GenomicEnd < _start || map.GenomicStart > _end)
{
continue;
}
int tempBegin = map.GenomicStart;
int tempEnd = map.GenomicEnd;
// trim the first and last exons
if (_start >= tempBegin && _start <= tempEnd)
{
tempBegin = _start;
}
if (_end >= tempBegin && _end <= tempEnd)
{
tempEnd = _end;
}
_sb.Append(_sequence.Substring(tempBegin - 1, tempEnd - tempBegin + 1));
}
// account for the exon phase (reverse orientation)
if (_startExonPhase > 0 && _geneOnReverseStrand)
{
_sb.Append('N', _startExonPhase);
}
return(_geneOnReverseStrand ? SequenceUtilities.GetReverseComplement(_sb.ToString()) : _sb.ToString());
}
/// <summary>
/// Retrieves all Exon sequences and concats them together.
/// This includes 5' UTR + cDNA + 3' UTR [Transcript.pm:862 spliced_seq]
/// </summary>
private static string GetSplicedSequence(ICompressedSequence compressedSequence, CdnaCoordinateMap[] cdnaMaps, bool onReverseStrand)
{
var sb = new StringBuilder();
foreach (var exon in cdnaMaps)
{
var exonLength = exon.GenomicEnd - exon.GenomicStart + 1;
// sanity check: handle the situation where no reference has been provided
if (compressedSequence == null)
{
sb.Append(new string('N', exonLength));
continue;
}
sb.Append(compressedSequence.Substring(exon.GenomicStart - 1, exonLength));
}
return(onReverseStrand ? SequenceUtilities.GetReverseComplement(sb.ToString()) : sb.ToString());
}
/// <summary>
/// return a string representing the cDNA-level effect of this allele in HGVS format [TranscriptVariationAllele.pm:568 hgvs_transcript]
/// </summary>
public void SetAnnotation()
{
// sanity check: don't try to handle odd characters, make sure this is not a reference allele,
// and make sure that we have protein coordinates
if (_variant.IsReference || SequenceUtilities.HasNonCanonicalBase(_ta.TranscriptAlternateAllele))
{
return;
}
GetGenomicChange(_transcript, _hgvsNotation, _isGenomicDuplicate);
GetCdnaPosition(_hgvsNotation.Start);
if (_hgvsStart == _hgvsEnd)
{
_hgvsNotation.End = _hgvsNotation.Start;
}
else
{
GetCdnaPosition(_hgvsNotation.End);
}
// sanity check: make sure we have coordinates
if (_hgvsNotation.Start.Position == null || _hgvsNotation.End.Position == null)
{
return;
}
var transcriptLen = _transcript.End - _transcript.Start + 1;
//_hgvs notation past the transcript
if (_hgvsNotation.Start.Position > transcriptLen || _hgvsNotation.End.Position > transcriptLen)
{
return;
}
// make sure that start is always less than end
SwapEndpoints(_hgvsNotation);
// generic formatting
_ta.HgvsCodingSequenceName = FormatHgvsString();
}
/// <summary>
/// return a string representing the protein-level effect of this allele in HGVS format [TranscriptVariationAllele.pm:717 hgvs_protein]
/// </summary>
public void SetAnnotation()
{
// sanity check: don't try to handle odd characters, make sure this is not a reference allele,
// and make sure that we have protein coordinates
if (_variant.IsReference || !_ta.HasValidCdsEnd || !_ta.HasValidCdsEnd ||
SequenceUtilities.HasNonCanonicalBase(_ta.TranscriptAlternateAllele))
{
return;
}
// check if this is a stop retained variant
if (_variantEffect.IsStopRetained())
{
_ta.HgvsProteinSequenceName = $"{_ta.HgvsCodingSequenceName}(p.=)";
return;
}
// clip the alleles
AminoAcids.RemovePrefixAndSuffix(_hgvsNotation);
// set the protein change
_hgvsNotation.Type = GetGeneralProteinChange();
if (_hgvsNotation.Type != ProteinChange.None)
{
_hgvsNotation.Type = GetSpecificProteinChange();
// convert ref & alt peptides taking into account HGVS rules
GetHgvsPeptides(_ta);
}
// no protein change - return transcript nomenclature with flag for neutral protein consequence
if (_hgvsNotation.Type == ProteinChange.None)
{
_ta.HgvsProteinSequenceName = $"{_ta.HgvsCodingSequenceName}(p.=)";
return;
}
// string formatting
_ta.HgvsProteinSequenceName = GetHgvsProteinFormat(_ta);
}
private void CheckNonCanonicalSpliceSurr(IAnnotatedTranscript ta, Transcript transcript,
HashSet <LofteeFilter.Filter> filters, ICompressedSequence sequence)
{
if (ta.Exons == null)
{
return;
}
int affectedExonIndex = Convert.ToInt32(ta.Exons.Split('/').First().Split('-').First());
var totalExons = transcript.CdnaMaps.Length;
string surrDonor = null;
string surrAcceptor = null;
if (totalExons <= 1)
{
return;
}
var onReverseStrand = transcript.Gene.OnReverseStrand;
if (affectedExonIndex > 1)
{
var intron = onReverseStrand ? transcript.Introns[totalExons - affectedExonIndex] : transcript.Introns[affectedExonIndex - 2];
int acceptorStart = onReverseStrand ? intron.Start : intron.End - 1;
var acceptorSeq = sequence.Substring(acceptorStart - 1, 2);
surrAcceptor = onReverseStrand ? SequenceUtilities.GetReverseComplement(acceptorSeq) : acceptorSeq;
}
if (affectedExonIndex < totalExons)
{
var intron = onReverseStrand ? transcript.Introns[totalExons - affectedExonIndex - 1] : transcript.Introns[affectedExonIndex - 1];
int donorStart = onReverseStrand ? intron.End - 1 : intron.Start;
var donorSeq = sequence.Substring(donorStart - 1, 2);
surrDonor = onReverseStrand ? SequenceUtilities.GetReverseComplement(donorSeq) : donorSeq;
}
if (surrAcceptor != null && surrAcceptor != "AG" || surrDonor != null && surrDonor != "GT")
{
filters.Add(LofteeFilter.Filter.non_can_splice_surr);
}
}
private void CheckNagnagSite(Transcript transcript, IAnnotatedAlternateAllele allele,
HashSet <LofteeFilter.Flag> flags, ICompressedSequence sequence)
{
if (allele.ReferenceBegin == null || allele.ReferenceEnd == null ||
allele.ReferenceBegin.Value != allele.ReferenceEnd.Value)
{
return;
}
int pos = allele.ReferenceBegin.Value;
string upStreamSeq = sequence.Substring(pos - 6, 6);
string downStreamSeq = sequence.Substring(pos, 5);
var combineSeq = transcript.Gene.OnReverseStrand
? SequenceUtilities.GetReverseComplement(upStreamSeq + downStreamSeq)
: upStreamSeq + downStreamSeq;
if (Regex.Match(combineSeq, "[A|T|C|G]AG[A|T|C|G]AG").Success)
{
flags.Add(LofteeFilter.Flag.nagnag_site);
}
}
public void NonCanonical(string bases)
{
Assert.True(SequenceUtilities.HasNonCanonicalBase(bases));
}
public static ISimpleVariant Right(ISimpleVariant simpleVariant, IInterval rotateRegion, ISequence refSequence, bool onReverseStrand)
{
if (refSequence == null)
{
return(simpleVariant);
}
if (simpleVariant.Type != VariantType.deletion && simpleVariant.Type != VariantType.insertion)
{
return(simpleVariant);
}
if (VariantStartOverlapsRegion(simpleVariant, rotateRegion, onReverseStrand))
{
return(simpleVariant);
}
// if variant is before the transcript start, do not perform 3 prime shift
string rotatingBases = GetRotatingBases(simpleVariant, onReverseStrand);
string downStreamSeq = GetDownstreamSeq(simpleVariant, rotateRegion, refSequence, onReverseStrand, rotatingBases);
string combinedSequence = rotatingBases + downStreamSeq;
int shiftStart, shiftEnd;
var hasShifted = false;
// probably a VEP bug, just use it for consistency
int numBases = rotatingBases.Length;
for (shiftStart = 0, shiftEnd = numBases; shiftEnd < combinedSequence.Length; shiftStart++, shiftEnd++)
{
if (combinedSequence[shiftStart] != combinedSequence[shiftEnd])
{
break;
}
hasShifted = true;
}
if (!hasShifted)
{
return(simpleVariant);
}
// create a new alternative allele
string rotatedSequence = combinedSequence.Substring(shiftStart, numBases);
int rotatedStart = simpleVariant.Start + shiftStart;
int rotatedEnd = simpleVariant.End + shiftStart;
if (onReverseStrand)
{
rotatedSequence = SequenceUtilities.GetReverseComplement(rotatedSequence);
rotatedStart = simpleVariant.Start - shiftStart;
rotatedEnd = simpleVariant.End - shiftStart;
}
string rotatedRefAllele = simpleVariant.RefAllele;
string rotatedAltAllele = simpleVariant.AltAllele;
if (simpleVariant.Type == VariantType.insertion)
{
rotatedAltAllele = rotatedSequence;
}
else
{
rotatedRefAllele = rotatedSequence;
}
return(new SimpleVariant(simpleVariant.Chromosome, rotatedStart, rotatedEnd, rotatedRefAllele,
rotatedAltAllele, simpleVariant.Type));
}
/// <summary>
/// get the genomic change that resulted from this variation [Sequence.pm:482 hgvs_variant_notation]
/// </summary>
private void GetGenomicChange(Transcript transcript, HgvsNotation hn, bool isGenomicDuplicate)
{
hn.Type = GenomicChange.Unknown;
// make sure our positions are defined
if (hn.Start.Position == null || hn.End.Position == null)
{
return;
}
int displayStart = (int)hn.Start.Position;
int displayEnd = (int)hn.End.Position;
// length of the reference allele. Negative lengths make no sense
int refLength = displayEnd - displayStart + 1;
if (refLength < 0)
{
refLength = 0;
}
// length of alternative allele
var altLength = hn.AlternateBases.Length;
// sanity check: make sure that the alleles are different
if (hn.ReferenceBases == hn.AlternateBases)
{
return;
}
// deletion
if (altLength == 0)
{
hn.Type = GenomicChange.Deletion;
return;
}
if (refLength == altLength)
{
// substitution
if (refLength == 1)
{
hn.Type = GenomicChange.Substitution;
return;
}
// inversion
var rcRefAllele = SequenceUtilities.GetReverseComplement(hn.ReferenceBases);
hn.Type = hn.AlternateBases == rcRefAllele ? GenomicChange.Inversion : GenomicChange.InDel;
return;
}
// If this is an insertion, we should check if the preceeding reference nucleotides
// match the insertion. In that case it should be annotated as a multiplication.
if (refLength == 0)
{
int prevPosition = displayEnd - altLength;
if (!isGenomicDuplicate && _compressedSequence != null && prevPosition >= 0)
{
// Get the same number of nucleotides preceding the insertion as the length of
// the insertion
var precedingBases = SequenceUtilities.GetSubSubstring(transcript.Start, transcript.End,
transcript.Gene.OnReverseStrand, prevPosition, prevPosition + altLength - 1, _compressedSequence);
if (precedingBases == hn.AlternateBases)
{
isGenomicDuplicate = true;
}
}
if (isGenomicDuplicate)
{
hn.Type = GenomicChange.Duplication;
// for duplication, the hgvs positions are deceremented by alt allele length
var incrementLength = altLength;
hn.Start.Position = displayStart - incrementLength;
hn.End.Position = hn.Start.Position + incrementLength - 1;
hn.AlleleMultiple = 2;
hn.ReferenceBases = hn.AlternateBases;
return;
}
// otherwise just an insertion
hn.Type = GenomicChange.Insertion;
hn.Start.Position = displayEnd;
hn.End.Position = displayStart;
return;
}
// Otherwise, the reference and allele are of different lengths. By default, this is
// a delins but we need to check if the alt allele is a multiplication of the reference.
// Check if the length of the alt allele is a multiple of the reference allele
if (altLength % refLength == 0)
{
hn.AlleleMultiple = altLength / refLength;
string multRefAllele = string.Concat(Enumerable.Repeat(hn.ReferenceBases, hn.AlleleMultiple));
if (hn.AlternateBases == multRefAllele)
{
hn.Type = hn.AlleleMultiple == 2 ? GenomicChange.Duplication : GenomicChange.Multiple;
return;
}
}
// deletion/insertion
hn.Type = GenomicChange.InDel;
}
public void HasNonCanonicalBase(string bases, bool expectedResult)
{
var observedResult = SequenceUtilities.HasNonCanonicalBase(bases);
Assert.Equal(expectedResult, observedResult);
}
public void GetReverseComplement(string bases, string expectedResult)
{
var observedResult = SequenceUtilities.GetReverseComplement(bases);
Assert.Equal(expectedResult, observedResult);
}
public void FindMotif_Tests(string needle, string haystack, IEnumerable <int> expected)
{
var actual = SequenceUtilities.FindMotif(needle, haystack).ToList();
CollectionAssert.AreEquivalent(expected, actual);
}
public static string GetHgvscAnnotation(ITranscript transcript, ISimpleVariant variant, ISequence refSequence,
int regionStart, int regionEnd, string transcriptRef, string transcriptAlt)
{
// sanity check: don't try to handle odd characters, make sure this is not a reference allele,
// and make sure that we have protein coordinates
if (variant.Type == VariantType.reference || SequenceUtilities.HasNonCanonicalBase(variant.AltAllele))
{
return(null);
}
// do not report HGVSc notation when variant lands inside gap region
if (regionStart > -1 && regionEnd > -1)
{
var startRegion = transcript.TranscriptRegions[regionStart];
var endRegion = transcript.TranscriptRegions[regionEnd];
if (startRegion.Id == endRegion.Id && startRegion.Type == TranscriptRegionType.Gap &&
endRegion.Type == TranscriptRegionType.Gap)
{
return(null);
}
}
bool onReverseStrand = transcript.Gene.OnReverseStrand;
string refAllele = string.IsNullOrEmpty(transcriptRef)? onReverseStrand ? SequenceUtilities.GetReverseComplement(variant.RefAllele) : variant.RefAllele
: transcriptRef;
string altAllele = string.IsNullOrEmpty(transcriptAlt)
? onReverseStrand ? SequenceUtilities.GetReverseComplement(variant.AltAllele) : variant.AltAllele
: transcriptAlt;
// decide event type from HGVS nomenclature
var genomicChange = GetGenomicChange(transcript, onReverseStrand, refSequence, variant);
int variantStart = variant.Start;
int variantEnd = variant.End;
if (genomicChange == GenomicChange.Duplication)
{
(variantStart, variantEnd, refAllele, regionStart, regionEnd) = transcript.TranscriptRegions.ShiftDuplication(variantStart, altAllele, onReverseStrand);
}
var startPositionOffset = HgvsUtilities.GetCdnaPositionOffset(transcript, variantStart, regionStart, true);
var endPositionOffset = variantStart == variantEnd
? startPositionOffset
: HgvsUtilities.GetCdnaPositionOffset(transcript, variantEnd, regionEnd, false);
if (onReverseStrand)
{
var tmp = startPositionOffset;
startPositionOffset = endPositionOffset;
endPositionOffset = tmp;
}
if (startPositionOffset == null && variant.Type == VariantType.insertion)
{
startPositionOffset = new PositionOffset(endPositionOffset.Position + 1, endPositionOffset.Offset, $"{endPositionOffset.Position + 1}", endPositionOffset.HasStopCodonNotation);
}
// sanity check: make sure we have coordinates
if (startPositionOffset == null || endPositionOffset == null)
{
return(null);
}
var hgvsNotation = new HgvscNotation(refAllele, altAllele, transcript.Id.WithVersion, genomicChange,
startPositionOffset, endPositionOffset, transcript.Translation != null);
// generic formatting
return(hgvsNotation.ToString());
}
