public void BasicIntervalTest() { var bamFilePath = Path.Combine(TestPaths.LocalTestDataDirectory, "Chr17Chr19.bam"); var vcfFilePath = Path.Combine(TestPaths.LocalTestDataDirectory, "Chr17Chr19.vcf"); var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup(); functionalTestRunner.GenomeDirectory = Path.Combine(TestPaths.SharedGenomesDirectory, "chr17chr19"); var expectedAlleles = new List <CalledAllele> { new CalledAllele(AlleleCategory.Snv) { ReferencePosition = 3118942, ReferenceAllele = "A", AlternateAllele = "T", Chromosome = "chr19" }, new CalledAllele(AlleleCategory.Snv) { ReferencePosition = 7572985, ReferenceAllele = "T", AlternateAllele = "C", Chromosome = "chr17" } }; // thread by chr functionalTestRunner.Execute(bamFilePath, vcfFilePath, null, expectedAlleles, threadByChr: true); }
public void BasicSNVIntervalTesting() { var bamFilePath = Path.Combine(TestPaths.LocalTestDataDirectory, "Chr17Chr19.bam"); var vcfFilePath = Path.Combine(TestPaths.LocalTestDataDirectory, "Chr17Chr19.vcf"); var intervalFilePath = Path.Combine(TestPaths.LocalTestDataDirectory, "chr17only.picard"); var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup(); functionalTestRunner.GenomeDirectory = Path.Combine(TestPaths.SharedGenomesDirectory, "chr17chr19"); var expectedAlleles = new List <CalledAllele> { new CalledAllele(AlleleCategory.Snv) { ReferencePosition = 3118942, ReferenceAllele = "A", AlternateAllele = "T", Chromosome = "chr19" }, new CalledAllele(AlleleCategory.Snv) { ReferencePosition = 7572985, ReferenceAllele = "T", AlternateAllele = "C", Chromosome = "chr17" } }; // Spot an expected allele inside an interval. functionalTestRunner.Execute(bamFilePath, vcfFilePath, intervalFilePath, expectedAlleles.Where(a => a.Chromosome == "chr17").ToList()); // Ignore indels spotted outside or overlapping the interval. functionalTestRunner.Execute(bamFilePath, vcfFilePath, intervalFilePath, expectedAlleles.Where(a => a.Chromosome == "chr17").ToList()); }
public void SomaticVariantCaller_SimpleSnv() { var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup(); functionalTestRunner.GenomeDirectory = Path.Combine(TestPaths.SharedGenomesDirectory, "chr17chr19"); var expectedAlleles = new List <CalledAllele> { new CalledAllele(AlleleCategory.Snv) { ReferencePosition = 3118942, ReferenceAllele = "A", AlternateAllele = "T", Chromosome = "chr19" } }; var vcfFilePath = Path.ChangeExtension(_bam_Sample, "vcf"); // without reference calls File.Delete(vcfFilePath); functionalTestRunner.Execute(_bam_Sample, vcfFilePath, null, expectedAlleles); // with reference calls File.Delete(vcfFilePath); functionalTestRunner.Execute(_bam_Sample, vcfFilePath, null, expectedAlleles, null, true, true, 102); // with reference calls and intervals File.Delete(vcfFilePath); functionalTestRunner.Execute(_bam_Sample, vcfFilePath, _interval_Sample, expectedAlleles, null, true, true, 11); // with reference calls and intervals that dont overlap variant File.Delete(vcfFilePath); functionalTestRunner.Execute(_bam_Sample, vcfFilePath, _interval_Sample_negative, new List <CalledAllele>(), null, true, true, 10); }
public void Pisces_Bcereus() // be serious. very, very, serious. { var bacilusBam = Path.Combine(TestPaths.SharedBamDirectory, "Bcereus_S4.bam"); var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup(); functionalTestRunner.GenomeDirectory = Path.Combine(TestPaths.SharedGenomesDirectory, "Bacillus_cereus", "Sequence", "WholeGenomeFasta"); functionalTestRunner.OutputDirectory = TestPaths.LocalScratchDirectory; var expectedAlleles = new List <CalledAllele> { new CalledAllele(AlleleCategory.Snv) { ReferencePosition = 827, ReferenceAllele = "A", AlternateAllele = "G", Chromosome = "chr" }, new CalledAllele(AlleleCategory.Snv) { ReferencePosition = 1480, ReferenceAllele = "A", AlternateAllele = "T", Chromosome = "chr" }, new CalledAllele(AlleleCategory.Snv) { ReferencePosition = 2282, ReferenceAllele = "A", AlternateAllele = "T", Chromosome = "chr" }, }; //chr 827.A G 100 PASS DP = 37 GT: GQ: AD: DP: VF: NL: SB 0 / 1:100:35,2:37:0.054:1000:-100.0000 //chr 1480.A T 100 PASS DP = 18 GT: GQ: AD: DP: VF: NL: SB 0 / 1:100:16,2:18:0.111:1000:-100.0000 //chr 2282.A T 100 PASS DP = 21 GT: GQ: AD: DP: VF: NL: SB 0 / 1:100:19,2:21:0.095:1000:-100.0000 PiscesApplicationOptions appOptions = new PiscesApplicationOptions(); appOptions.VcfWritingParameters.OutputGvcfFile = true; appOptions.BAMPaths = new string[] { bacilusBam }; appOptions.GenomePaths = new string[] { functionalTestRunner.GenomeDirectory }; appOptions.OutputDirectory = functionalTestRunner.OutputDirectory; appOptions.VariantCallingParameters.NoiseLevelUsedForQScoring = 1000; var vcfFilePath = Path.Combine(TestPaths.LocalScratchDirectory, "Bcereus_S4.genome.vcf"); // without reference calls File.Delete(vcfFilePath); functionalTestRunner.Execute(bacilusBam, vcfFilePath, null, expectedAlleles, applicationOptions: appOptions); }
public void BasicMnvTesting() { var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup(); functionalTestRunner.GenomeDirectory = Path.Combine(TestPaths.SharedGenomesDirectory, "chr17chr19"); // Mock ChrReference for the MockGenome. List <ChrReference> mockChrRef = new List <ChrReference>() { new ChrReference() { Name = "chr1", Sequence = "TTGTCAGTGCGCTTTTCCCAACACCACCTGCTCCGACCACCACCAGTTTGTACTCAGTCATTTCACACCAGCAAGAACCTGTTGGAAACCAGTAATCAGGGTTAATTGGCGGCG" } }; var expectedAlleles = new List <CalledAllele> { new CalledAllele(AlleleCategory.Mnv) { ReferencePosition = 27, ReferenceAllele = "CCTGCTCCG", AlternateAllele = "TTTGCTCCA", Chromosome = "chr1" }, new CalledAllele(AlleleCategory.Mnv) { ReferencePosition = 27, ReferenceAllele = "CC", AlternateAllele = "TT", Chromosome = "chr1" }, new CalledAllele(AlleleCategory.Snv) { ReferencePosition = 35, ReferenceAllele = "G", AlternateAllele = "A", Chromosome = "chr1" } }; // Testing small_S1.bam with a MockGenome. functionalTestRunner.Execute(_bamSmallS1, Path.ChangeExtension(_bamSmallS1, "vcf"), null, expectedAlleles, mockChrRef, doCheckReferences: true, doLog: true, collapse: false); }
public void Pisces_PhiX() //Phix it and forget it. { var bacilusBam = Path.Combine(TestPaths.SharedBamDirectory, "PhiX_S3.bam"); var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup(); functionalTestRunner.GenomeDirectory = Path.Combine(TestPaths.SharedGenomesDirectory, "PhiX", "WholeGenomeFasta"); functionalTestRunner.OutputDirectory = TestPaths.LocalScratchDirectory; var expectedAlleles = new List <CalledAllele> { new CalledAllele(AlleleCategory.Snv) { ReferencePosition = 14, ReferenceAllele = "T", AlternateAllele = "C", Chromosome = "phix" }, new CalledAllele(AlleleCategory.Snv) { ReferencePosition = 14, ReferenceAllele = "T", AlternateAllele = "G", Chromosome = "phix" }, new CalledAllele(AlleleCategory.Snv) { ReferencePosition = 19, ReferenceAllele = "G", AlternateAllele = "T", Chromosome = "phix" }, new CalledAllele(AlleleCategory.Snv) { ReferencePosition = 22, ReferenceAllele = "G", AlternateAllele = "A", Chromosome = "phix" }, new CalledAllele(AlleleCategory.Snv) { ReferencePosition = 25, ReferenceAllele = "G", AlternateAllele = "T", Chromosome = "phix" }, new CalledAllele(AlleleCategory.Snv) { ReferencePosition = 26, ReferenceAllele = "A", AlternateAllele = "C", Chromosome = "phix" }, new CalledAllele(AlleleCategory.Snv) { ReferencePosition = 42, ReferenceAllele = "A", AlternateAllele = "T", Chromosome = "phix" } }; //phix 14.T C 3 q30; LowVariantFreq DP = 236 GT: GQ: AD: DP: VF: NL: SB 0 / 1:3:234,1:236:0.00424:1000:-100.0000 //phix 14.T G 3 q30; LowVariantFreq DP = 236 GT: GQ: AD: DP: VF: NL: SB 0 / 1:3:234,1:236:0.00424:1000:-100.0000 //phix 19.G T 3 q30; LowVariantFreq DP = 243 GT: GQ: AD: DP: VF: NL: SB 0 / 1:3:242,1:243:0.00412:1000:-100.0000 //phix 22.G A 3 q30; LowVariantFreq DP = 225 GT: GQ: AD: DP: VF: NL: SB 0 / 1:3:224,1:225:0.00444:1000:-100.0000 //phix 25.G T 3 q30; LowVariantFreq DP = 244 GT: GQ: AD: DP: VF: NL: SB 0 / 1:3:243,1:244:0.00410:1000:-100.0000 //phix 26.A C 3 q30; LowVariantFreq DP = 242 GT: GQ: AD: DP: VF: NL: SB 0 / 1:3:241,1:242:0.00413:1000:-100.0000 //phix 42.A T 3 q30; LowVariantFreq DP = 199 GT: GQ: AD: DP: VF: NL: SB 0 / 1:3:198,1:199:0.00503:1000:-100.0000 PiscesApplicationOptions appOptions = new PiscesApplicationOptions(); appOptions.VcfWritingParameters.OutputGvcfFile = true; appOptions.BAMPaths = new string[] { bacilusBam }; appOptions.GenomePaths = new string[] { functionalTestRunner.GenomeDirectory }; appOptions.OutputDirectory = functionalTestRunner.OutputDirectory; appOptions.VariantCallingParameters.NoiseLevelUsedForQScoring = 1000; appOptions.VariantCallingParameters.MinimumFrequency = 0.0001f; //make sure we catch something in this little bam appOptions.VariantCallingParameters.MinimumVariantQScore = 3; //make sure we catch something in this little bam var vcfFilePath = Path.Combine(TestPaths.LocalScratchDirectory, "PhiX_S3.genome.vcf"); // without reference calls File.Delete(vcfFilePath); functionalTestRunner.Execute(bacilusBam, vcfFilePath, null, expectedAlleles, applicationOptions: appOptions); }
public void StitchedCollapsedBamGroundTruth() { // SNP ground truth from TingTing var bamFilePath = Path.Combine(TestPaths.LocalTestDataDirectory, "collapsed.test.stitched.bam"); var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup(); functionalTestRunner.GenomeDirectory = Path.Combine(TestPaths.SharedGenomesDirectory, "chr1"); var appOptions = new PiscesApplicationOptions { BAMPaths = new[] { bamFilePath }, IntervalPaths = null, GenomePaths = new[] { Path.Combine(TestPaths.SharedGenomesDirectory, "chr1") }, OutputBiasFiles = true, DebugMode = true, CallMNVs = true, UseMNVReallocation = false, MaxSizeMNV = 100, MaxGapBetweenMNV = 10, NoiseModelHalfWindow = 1, BamFilterParameters = new BamFilterParameters() { MinimumBaseCallQuality = 20, MinimumMapQuality = 1, OnlyUseProperPairs = false, }, VariantCallingParameters = new VariantCallingParameters() { MaximumVariantQScore = 100, MinimumVariantQScoreFilter = 30, MinimumVariantQScore = 20, MinimumCoverage = 10, MinimumFrequency = 0.01f, FilterOutVariantsPresentOnlyOneStrand = false, ForcedNoiseLevel = -1, NoiseModel = NoiseModel.Flat, StrandBiasModel = StrandBiasModel.Extended, AmpliconBiasFilterThreshold = 0.01F }, VcfWritingParameters = new Domain.Options.VcfWritingParameters() { OutputGvcfFile = true, ReportRcCounts = true, ReportTsCounts = true } }; // Time to build the fake sequences for testing. var mockChrRef = new List <ChrReference>() { new ChrReference() { // position 9770498 ~ 9770669 Name = "chr1", Sequence = new string('N', 9770498 - 1) + "GAAGTAACAACGCAGGATGCCCCCTGGGGTGGACTGCCCCATGGAATTCTGGACCAAGGAGGAGAATCAGAGCGTTGTGGTTGACTTCCTGCTGCCCACAGGGGTCTACCTGAACTTCCCTGTGTCCCGCAATGCCAACCTCAGCACCATCAAGCAGGTATGGCCTCCATC" } }; var expectedAlleles = new List <CalledAllele> { new CalledAllele(AlleleCategory.Snv) { ReferencePosition = 9770596, ReferenceAllele = "C", AlternateAllele = "A", Chromosome = "chr1" } }; functionalTestRunner.Execute(bamFilePath, Path.ChangeExtension(bamFilePath, "genome.vcf"), null, expectedAlleles, mockChrRef, applicationOptions: appOptions); var truthvcfFilePath = Path.Combine(Path.GetDirectoryName(appOptions.BAMPaths[0]), "test_truth.stitched.genome.vcf"); var stitchedCollapsedTruth = AlleleReader.GetAllVariantsInFile(truthvcfFilePath); var resultFilePath = Path.ChangeExtension(bamFilePath, "genome.vcf"); var stitchedCollapsedResults = AlleleReader.GetAllVariantsInFile(resultFilePath); TestUtilities.TestHelper.CompareFiles(truthvcfFilePath, resultFilePath); }
public void InsertionAtEdgeOfDistribution() { // This test was brought forward to test Deletion at the edge from the previous tests. The test was listed as failing when stitching was included. // Notes from Old SVC: Make sure we can accurately insertions at the edge of the coverage distribution, and not accidentally mark them as SB // This test case was in response to a bug, where originally we called SB here when we should not. // chr7 116376907 . ATTT A 100.00 SB DP=750; var bamFilePath = Path.Combine(TestPaths.LocalTestDataDirectory, "edgeIns_S2.bam"); var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup(); functionalTestRunner.GenomeDirectory = Path.Combine(TestPaths.SharedGenomesDirectory, "chr17chr19"); var appOptions = new PiscesApplicationOptions { BAMPaths = new[] { bamFilePath }, IntervalPaths = null, GenomePaths = new[] { Path.Combine(TestPaths.SharedGenomesDirectory, "chr17chr19") }, OutputBiasFiles = true, DebugMode = true, CallMNVs = true, UseMNVReallocation = false, MaxSizeMNV = 100, MaxGapBetweenMNV = 10, NoiseModelHalfWindow = 1, BamFilterParameters = new Domain.Options.BamFilterParameters() { MinimumBaseCallQuality = 20, MinimumMapQuality = 1, OnlyUseProperPairs = false, }, VariantCallingParameters = new Domain.Options.VariantCallingParameters() { MaximumVariantQScore = 100, MinimumVariantQScoreFilter = 30, MinimumVariantQScore = 20, MinimumCoverage = 10, MinimumFrequency = 0.01f, FilterOutVariantsPresentOnlyOneStrand = false, ForcedNoiseLevel = -1, NoiseModel = NoiseModel.Flat, StrandBiasModel = StrandBiasModel.Extended, }, VcfWritingParameters = new Domain.Options.VcfWritingParameters() { OutputGvcfFile = true, } }; // Time to build the fake sequences for testing. var mockChrRef = new List <ChrReference>() { new ChrReference() { // position 63 Name = "chr7", Sequence = "NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN" + "GTTGGTCTTCTATTTTATGCGAATTCTTCTAAGATTCCCAGGTTATTTATCATAAGAATTACATTTACATGGCAAATTTAGTTCTGTTCCTAGAAATATCTCCATGACAACCAAAAGGAACTCCTAATTTCTGGCACACATTACTTCAGGGGT" } }; var expectedAlleles = new List <CalledAllele> { new CalledAllele(AlleleCategory.Insertion) { ReferencePosition = 110, ReferenceAllele = "T", AlternateAllele = "TGGG", Chromosome = "chr7" } }; functionalTestRunner.Execute(bamFilePath, Path.ChangeExtension(bamFilePath, "genome.vcf"), null, expectedAlleles, mockChrRef, applicationOptions: appOptions); }
public void DeletionAtEdgeOfDistribution() { // This test was brought forward to test Deletion at the edge from the previous tests. The test was listed as failing when stitching was included. // Notes from Old SVC: Make sure we can accurately deletions at the edge of the coverage distribution, and not accidentally mark them as SB // This test case was in response to a bug, where originally we called SB here when we should not. // chr7 116376907 . ATTT A 100.00 SB DP=750; var bamFilePath = Path.Combine(UnitTestPaths.TestDataDirectory, "edgeIndel_S2.bam"); var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup(); functionalTestRunner.GenomeDirectory = Path.Combine(UnitTestPaths.TestGenomesDirectory, "chr17chr19"); var appOptions = new ApplicationOptions { BAMPaths = new[] { bamFilePath }, IntervalPaths = null, GenomePaths = new[] { Path.Combine(UnitTestPaths.TestGenomesDirectory, "chr17chr19") }, OutputgVCFFiles = true, OutputBiasFiles = true, DebugMode = true, CallMNVs = true, UseMNVReallocation = false, MaxSizeMNV = 100, FilterOutVariantsPresentOnlyOneStrand = false, AppliedNoiseLevel = -1, MinimumBaseCallQuality = 20, MaximumVariantQScore = 100, FilteredVariantQScore = 30, MinimumVariantQScore = 20, MaxGapBetweenMNV = 10, MinimumDepth = 10, MinimumMapQuality = 1, MinimumFrequency = 0.01f, StrandBiasAcceptanceCriteria = 0.5f, StrandBiasScoreMaximumToWriteToVCF = -100, StrandBiasScoreMinimumToWriteToVCF = 0, OnlyUseProperPairs = false, NoiseModelHalfWindow = 1, NoiseModel = NoiseModel.Flat, StrandBiasModel = StrandBiasModel.Extended }; var mockChrRef = new List <ChrReference>() { new ChrReference() { // position 63 Name = "chr7", Sequence = "NNNNNNNNNNNNNNNNNNNN" + "NNNNNNNNNNNNNNNNNNNN" + "NNNNNNNNNNNNNNNNNNNN" + "NN" + "GTTGGTCTTCTATTTTATGCGAATTCTTCTAAGATTCCCAGGTTATTTATCATAAGAATTACATTTACATGGCAAATTTAGTTCTGTTCCTAGAAATATCTCCATGACAACCAAAAGGAACTCCTAATTTCTGGCACACATTACTTCAGGGGT" } }; var expectedAlleles = new List <CalledAllele> { new CalledAllele(AlleleCategory.Deletion) { Coordinate = 107, Reference = "ATTT", Alternate = "A", Chromosome = "chr7" } }; functionalTestRunner.Execute(bamFilePath, Path.ChangeExtension(bamFilePath, "genome.vcf"), null, expectedAlleles, mockChrRef, applicationOptions: appOptions); }