public void BasicIntervalTest()
{
var bamFilePath = Path.Combine(TestPaths.LocalTestDataDirectory, "Chr17Chr19.bam");
var vcfFilePath = Path.Combine(TestPaths.LocalTestDataDirectory, "Chr17Chr19.vcf");
var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup();
functionalTestRunner.GenomeDirectory = Path.Combine(TestPaths.SharedGenomesDirectory, "chr17chr19");
var expectedAlleles = new List <CalledAllele>
{
new CalledAllele(AlleleCategory.Snv)
{
ReferencePosition = 3118942,
ReferenceAllele = "A",
AlternateAllele = "T",
Chromosome = "chr19"
},
new CalledAllele(AlleleCategory.Snv)
{
ReferencePosition = 7572985,
ReferenceAllele = "T",
AlternateAllele = "C",
Chromosome = "chr17"
}
};
// thread by chr
functionalTestRunner.Execute(bamFilePath, vcfFilePath, null, expectedAlleles, threadByChr: true);
}
public void BasicSNVIntervalTesting()
{
var bamFilePath = Path.Combine(TestPaths.LocalTestDataDirectory, "Chr17Chr19.bam");
var vcfFilePath = Path.Combine(TestPaths.LocalTestDataDirectory, "Chr17Chr19.vcf");
var intervalFilePath = Path.Combine(TestPaths.LocalTestDataDirectory, "chr17only.picard");
var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup();
functionalTestRunner.GenomeDirectory = Path.Combine(TestPaths.SharedGenomesDirectory, "chr17chr19");
var expectedAlleles = new List <CalledAllele>
{
new CalledAllele(AlleleCategory.Snv)
{
ReferencePosition = 3118942,
ReferenceAllele = "A",
AlternateAllele = "T",
Chromosome = "chr19"
},
new CalledAllele(AlleleCategory.Snv)
{
ReferencePosition = 7572985,
ReferenceAllele = "T",
AlternateAllele = "C",
Chromosome = "chr17"
}
};
// Spot an expected allele inside an interval.
functionalTestRunner.Execute(bamFilePath, vcfFilePath, intervalFilePath, expectedAlleles.Where(a => a.Chromosome == "chr17").ToList());
// Ignore indels spotted outside or overlapping the interval.
functionalTestRunner.Execute(bamFilePath, vcfFilePath, intervalFilePath, expectedAlleles.Where(a => a.Chromosome == "chr17").ToList());
}
public void SomaticVariantCaller_SimpleSnv()
{
var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup();
functionalTestRunner.GenomeDirectory = Path.Combine(TestPaths.SharedGenomesDirectory, "chr17chr19");
var expectedAlleles = new List <CalledAllele>
{
new CalledAllele(AlleleCategory.Snv)
{
ReferencePosition = 3118942,
ReferenceAllele = "A",
AlternateAllele = "T",
Chromosome = "chr19"
}
};
var vcfFilePath = Path.ChangeExtension(_bam_Sample, "vcf");
// without reference calls
File.Delete(vcfFilePath);
functionalTestRunner.Execute(_bam_Sample, vcfFilePath, null, expectedAlleles);
// with reference calls
File.Delete(vcfFilePath);
functionalTestRunner.Execute(_bam_Sample, vcfFilePath, null, expectedAlleles, null, true, true, 102);
// with reference calls and intervals
File.Delete(vcfFilePath);
functionalTestRunner.Execute(_bam_Sample, vcfFilePath, _interval_Sample, expectedAlleles, null, true, true, 11);
// with reference calls and intervals that dont overlap variant
File.Delete(vcfFilePath);
functionalTestRunner.Execute(_bam_Sample, vcfFilePath, _interval_Sample_negative, new List <CalledAllele>(), null, true, true, 10);
}
public void Pisces_Bcereus() // be serious. very, very, serious.
{
var bacilusBam = Path.Combine(TestPaths.SharedBamDirectory, "Bcereus_S4.bam");
var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup();
functionalTestRunner.GenomeDirectory = Path.Combine(TestPaths.SharedGenomesDirectory, "Bacillus_cereus", "Sequence", "WholeGenomeFasta");
functionalTestRunner.OutputDirectory = TestPaths.LocalScratchDirectory;
var expectedAlleles = new List <CalledAllele>
{
new CalledAllele(AlleleCategory.Snv)
{
ReferencePosition = 827,
ReferenceAllele = "A",
AlternateAllele = "G",
Chromosome = "chr"
},
new CalledAllele(AlleleCategory.Snv)
{
ReferencePosition = 1480,
ReferenceAllele = "A",
AlternateAllele = "T",
Chromosome = "chr"
},
new CalledAllele(AlleleCategory.Snv)
{
ReferencePosition = 2282,
ReferenceAllele = "A",
AlternateAllele = "T",
Chromosome = "chr"
},
};
//chr 827.A G 100 PASS DP = 37 GT: GQ: AD: DP: VF: NL: SB 0 / 1:100:35,2:37:0.054:1000:-100.0000
//chr 1480.A T 100 PASS DP = 18 GT: GQ: AD: DP: VF: NL: SB 0 / 1:100:16,2:18:0.111:1000:-100.0000
//chr 2282.A T 100 PASS DP = 21 GT: GQ: AD: DP: VF: NL: SB 0 / 1:100:19,2:21:0.095:1000:-100.0000
PiscesApplicationOptions appOptions = new PiscesApplicationOptions();
appOptions.VcfWritingParameters.OutputGvcfFile = true;
appOptions.BAMPaths = new string[] { bacilusBam };
appOptions.GenomePaths = new string[] { functionalTestRunner.GenomeDirectory };
appOptions.OutputDirectory = functionalTestRunner.OutputDirectory;
appOptions.VariantCallingParameters.NoiseLevelUsedForQScoring = 1000;
var vcfFilePath = Path.Combine(TestPaths.LocalScratchDirectory, "Bcereus_S4.genome.vcf");
// without reference calls
File.Delete(vcfFilePath);
functionalTestRunner.Execute(bacilusBam, vcfFilePath, null, expectedAlleles, applicationOptions: appOptions);
}
public void BasicMnvTesting()
{
var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup();
functionalTestRunner.GenomeDirectory = Path.Combine(TestPaths.SharedGenomesDirectory, "chr17chr19");
// Mock ChrReference for the MockGenome.
List <ChrReference> mockChrRef = new List <ChrReference>()
{
new ChrReference()
{
Name = "chr1",
Sequence = "TTGTCAGTGCGCTTTTCCCAACACCACCTGCTCCGACCACCACCAGTTTGTACTCAGTCATTTCACACCAGCAAGAACCTGTTGGAAACCAGTAATCAGGGTTAATTGGCGGCG"
}
};
var expectedAlleles = new List <CalledAllele>
{
new CalledAllele(AlleleCategory.Mnv)
{
ReferencePosition = 27,
ReferenceAllele = "CCTGCTCCG",
AlternateAllele = "TTTGCTCCA",
Chromosome = "chr1"
},
new CalledAllele(AlleleCategory.Mnv)
{
ReferencePosition = 27,
ReferenceAllele = "CC",
AlternateAllele = "TT",
Chromosome = "chr1"
},
new CalledAllele(AlleleCategory.Snv)
{
ReferencePosition = 35,
ReferenceAllele = "G",
AlternateAllele = "A",
Chromosome = "chr1"
}
};
// Testing small_S1.bam with a MockGenome.
functionalTestRunner.Execute(_bamSmallS1, Path.ChangeExtension(_bamSmallS1, "vcf"), null, expectedAlleles, mockChrRef, doCheckReferences: true, doLog: true, collapse: false);
}
public void Pisces_PhiX() //Phix it and forget it.
{
var bacilusBam = Path.Combine(TestPaths.SharedBamDirectory, "PhiX_S3.bam");
var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup();
functionalTestRunner.GenomeDirectory = Path.Combine(TestPaths.SharedGenomesDirectory, "PhiX", "WholeGenomeFasta");
functionalTestRunner.OutputDirectory = TestPaths.LocalScratchDirectory;
var expectedAlleles = new List <CalledAllele>
{
new CalledAllele(AlleleCategory.Snv)
{
ReferencePosition = 14,
ReferenceAllele = "T",
AlternateAllele = "C",
Chromosome = "phix"
},
new CalledAllele(AlleleCategory.Snv)
{
ReferencePosition = 14,
ReferenceAllele = "T",
AlternateAllele = "G",
Chromosome = "phix"
},
new CalledAllele(AlleleCategory.Snv)
{
ReferencePosition = 19,
ReferenceAllele = "G",
AlternateAllele = "T",
Chromosome = "phix"
},
new CalledAllele(AlleleCategory.Snv)
{
ReferencePosition = 22,
ReferenceAllele = "G",
AlternateAllele = "A",
Chromosome = "phix"
},
new CalledAllele(AlleleCategory.Snv)
{
ReferencePosition = 25,
ReferenceAllele = "G",
AlternateAllele = "T",
Chromosome = "phix"
},
new CalledAllele(AlleleCategory.Snv)
{
ReferencePosition = 26,
ReferenceAllele = "A",
AlternateAllele = "C",
Chromosome = "phix"
},
new CalledAllele(AlleleCategory.Snv)
{
ReferencePosition = 42,
ReferenceAllele = "A",
AlternateAllele = "T",
Chromosome = "phix"
}
};
//phix 14.T C 3 q30; LowVariantFreq DP = 236 GT: GQ: AD: DP: VF: NL: SB 0 / 1:3:234,1:236:0.00424:1000:-100.0000
//phix 14.T G 3 q30; LowVariantFreq DP = 236 GT: GQ: AD: DP: VF: NL: SB 0 / 1:3:234,1:236:0.00424:1000:-100.0000
//phix 19.G T 3 q30; LowVariantFreq DP = 243 GT: GQ: AD: DP: VF: NL: SB 0 / 1:3:242,1:243:0.00412:1000:-100.0000
//phix 22.G A 3 q30; LowVariantFreq DP = 225 GT: GQ: AD: DP: VF: NL: SB 0 / 1:3:224,1:225:0.00444:1000:-100.0000
//phix 25.G T 3 q30; LowVariantFreq DP = 244 GT: GQ: AD: DP: VF: NL: SB 0 / 1:3:243,1:244:0.00410:1000:-100.0000
//phix 26.A C 3 q30; LowVariantFreq DP = 242 GT: GQ: AD: DP: VF: NL: SB 0 / 1:3:241,1:242:0.00413:1000:-100.0000
//phix 42.A T 3 q30; LowVariantFreq DP = 199 GT: GQ: AD: DP: VF: NL: SB 0 / 1:3:198,1:199:0.00503:1000:-100.0000
PiscesApplicationOptions appOptions = new PiscesApplicationOptions();
appOptions.VcfWritingParameters.OutputGvcfFile = true;
appOptions.BAMPaths = new string[] { bacilusBam };
appOptions.GenomePaths = new string[] { functionalTestRunner.GenomeDirectory };
appOptions.OutputDirectory = functionalTestRunner.OutputDirectory;
appOptions.VariantCallingParameters.NoiseLevelUsedForQScoring = 1000;
appOptions.VariantCallingParameters.MinimumFrequency = 0.0001f; //make sure we catch something in this little bam
appOptions.VariantCallingParameters.MinimumVariantQScore = 3; //make sure we catch something in this little bam
var vcfFilePath = Path.Combine(TestPaths.LocalScratchDirectory, "PhiX_S3.genome.vcf");
// without reference calls
File.Delete(vcfFilePath);
functionalTestRunner.Execute(bacilusBam, vcfFilePath, null, expectedAlleles, applicationOptions: appOptions);
}
public void StitchedCollapsedBamGroundTruth()
{
// SNP ground truth from TingTing
var bamFilePath = Path.Combine(TestPaths.LocalTestDataDirectory, "collapsed.test.stitched.bam");
var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup();
functionalTestRunner.GenomeDirectory = Path.Combine(TestPaths.SharedGenomesDirectory, "chr1");
var appOptions = new PiscesApplicationOptions
{
BAMPaths = new[] { bamFilePath },
IntervalPaths = null,
GenomePaths = new[] { Path.Combine(TestPaths.SharedGenomesDirectory, "chr1") },
OutputBiasFiles = true,
DebugMode = true,
CallMNVs = true,
UseMNVReallocation = false,
MaxSizeMNV = 100,
MaxGapBetweenMNV = 10,
NoiseModelHalfWindow = 1,
BamFilterParameters = new BamFilterParameters()
{
MinimumBaseCallQuality = 20,
MinimumMapQuality = 1,
OnlyUseProperPairs = false,
},
VariantCallingParameters = new VariantCallingParameters()
{
MaximumVariantQScore = 100,
MinimumVariantQScoreFilter = 30,
MinimumVariantQScore = 20,
MinimumCoverage = 10,
MinimumFrequency = 0.01f,
FilterOutVariantsPresentOnlyOneStrand = false,
ForcedNoiseLevel = -1,
NoiseModel = NoiseModel.Flat,
StrandBiasModel = StrandBiasModel.Extended,
AmpliconBiasFilterThreshold = 0.01F
},
VcfWritingParameters = new Domain.Options.VcfWritingParameters()
{
OutputGvcfFile = true,
ReportRcCounts = true,
ReportTsCounts = true
}
};
// Time to build the fake sequences for testing.
var mockChrRef = new List <ChrReference>()
{
new ChrReference()
{
// position 9770498 ~ 9770669
Name = "chr1",
Sequence = new string('N', 9770498 - 1) + "GAAGTAACAACGCAGGATGCCCCCTGGGGTGGACTGCCCCATGGAATTCTGGACCAAGGAGGAGAATCAGAGCGTTGTGGTTGACTTCCTGCTGCCCACAGGGGTCTACCTGAACTTCCCTGTGTCCCGCAATGCCAACCTCAGCACCATCAAGCAGGTATGGCCTCCATC"
}
};
var expectedAlleles = new List <CalledAllele>
{
new CalledAllele(AlleleCategory.Snv)
{
ReferencePosition = 9770596,
ReferenceAllele = "C",
AlternateAllele = "A",
Chromosome = "chr1"
}
};
functionalTestRunner.Execute(bamFilePath, Path.ChangeExtension(bamFilePath, "genome.vcf"), null, expectedAlleles, mockChrRef, applicationOptions: appOptions);
var truthvcfFilePath = Path.Combine(Path.GetDirectoryName(appOptions.BAMPaths[0]), "test_truth.stitched.genome.vcf");
var stitchedCollapsedTruth = AlleleReader.GetAllVariantsInFile(truthvcfFilePath);
var resultFilePath = Path.ChangeExtension(bamFilePath, "genome.vcf");
var stitchedCollapsedResults = AlleleReader.GetAllVariantsInFile(resultFilePath);
TestUtilities.TestHelper.CompareFiles(truthvcfFilePath, resultFilePath);
}
public void InsertionAtEdgeOfDistribution()
{
// This test was brought forward to test Deletion at the edge from the previous tests. The test was listed as failing when stitching was included.
// Notes from Old SVC: Make sure we can accurately insertions at the edge of the coverage distribution, and not accidentally mark them as SB
// This test case was in response to a bug, where originally we called SB here when we should not.
// chr7 116376907 . ATTT A 100.00 SB DP=750;
var bamFilePath = Path.Combine(TestPaths.LocalTestDataDirectory, "edgeIns_S2.bam");
var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup();
functionalTestRunner.GenomeDirectory = Path.Combine(TestPaths.SharedGenomesDirectory, "chr17chr19");
var appOptions = new PiscesApplicationOptions
{
BAMPaths = new[] { bamFilePath },
IntervalPaths = null,
GenomePaths = new[] { Path.Combine(TestPaths.SharedGenomesDirectory, "chr17chr19") },
OutputBiasFiles = true,
DebugMode = true,
CallMNVs = true,
UseMNVReallocation = false,
MaxSizeMNV = 100,
MaxGapBetweenMNV = 10,
NoiseModelHalfWindow = 1,
BamFilterParameters = new Domain.Options.BamFilterParameters()
{
MinimumBaseCallQuality = 20,
MinimumMapQuality = 1,
OnlyUseProperPairs = false,
},
VariantCallingParameters = new Domain.Options.VariantCallingParameters()
{
MaximumVariantQScore = 100,
MinimumVariantQScoreFilter = 30,
MinimumVariantQScore = 20,
MinimumCoverage = 10,
MinimumFrequency = 0.01f,
FilterOutVariantsPresentOnlyOneStrand = false,
ForcedNoiseLevel = -1,
NoiseModel = NoiseModel.Flat,
StrandBiasModel = StrandBiasModel.Extended,
},
VcfWritingParameters = new Domain.Options.VcfWritingParameters()
{
OutputGvcfFile = true,
}
};
// Time to build the fake sequences for testing.
var mockChrRef = new List <ChrReference>()
{
new ChrReference()
{
// position 63
Name = "chr7",
Sequence = "NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN" +
"GTTGGTCTTCTATTTTATGCGAATTCTTCTAAGATTCCCAGGTTATTTATCATAAGAATTACATTTACATGGCAAATTTAGTTCTGTTCCTAGAAATATCTCCATGACAACCAAAAGGAACTCCTAATTTCTGGCACACATTACTTCAGGGGT"
}
};
var expectedAlleles = new List <CalledAllele>
{
new CalledAllele(AlleleCategory.Insertion)
{
ReferencePosition = 110,
ReferenceAllele = "T",
AlternateAllele = "TGGG",
Chromosome = "chr7"
}
};
functionalTestRunner.Execute(bamFilePath, Path.ChangeExtension(bamFilePath, "genome.vcf"), null, expectedAlleles, mockChrRef, applicationOptions: appOptions);
}
public void DeletionAtEdgeOfDistribution()
{
// This test was brought forward to test Deletion at the edge from the previous tests. The test was listed as failing when stitching was included.
// Notes from Old SVC: Make sure we can accurately deletions at the edge of the coverage distribution, and not accidentally mark them as SB
// This test case was in response to a bug, where originally we called SB here when we should not.
// chr7 116376907 . ATTT A 100.00 SB DP=750;
var bamFilePath = Path.Combine(UnitTestPaths.TestDataDirectory, "edgeIndel_S2.bam");
var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup();
functionalTestRunner.GenomeDirectory = Path.Combine(UnitTestPaths.TestGenomesDirectory, "chr17chr19");
var appOptions = new ApplicationOptions
{
BAMPaths = new[] { bamFilePath },
IntervalPaths = null,
GenomePaths = new[] { Path.Combine(UnitTestPaths.TestGenomesDirectory, "chr17chr19") },
OutputgVCFFiles = true,
OutputBiasFiles = true,
DebugMode = true,
CallMNVs = true,
UseMNVReallocation = false,
MaxSizeMNV = 100,
FilterOutVariantsPresentOnlyOneStrand = false,
AppliedNoiseLevel = -1,
MinimumBaseCallQuality = 20,
MaximumVariantQScore = 100,
FilteredVariantQScore = 30,
MinimumVariantQScore = 20,
MaxGapBetweenMNV = 10,
MinimumDepth = 10,
MinimumMapQuality = 1,
MinimumFrequency = 0.01f,
StrandBiasAcceptanceCriteria = 0.5f,
StrandBiasScoreMaximumToWriteToVCF = -100,
StrandBiasScoreMinimumToWriteToVCF = 0,
OnlyUseProperPairs = false,
NoiseModelHalfWindow = 1,
NoiseModel = NoiseModel.Flat,
StrandBiasModel = StrandBiasModel.Extended
};
var mockChrRef = new List <ChrReference>()
{
new ChrReference()
{
// position 63
Name = "chr7",
Sequence = "NNNNNNNNNNNNNNNNNNNN" + "NNNNNNNNNNNNNNNNNNNN" + "NNNNNNNNNNNNNNNNNNNN" + "NN" +
"GTTGGTCTTCTATTTTATGCGAATTCTTCTAAGATTCCCAGGTTATTTATCATAAGAATTACATTTACATGGCAAATTTAGTTCTGTTCCTAGAAATATCTCCATGACAACCAAAAGGAACTCCTAATTTCTGGCACACATTACTTCAGGGGT"
}
};
var expectedAlleles = new List <CalledAllele>
{
new CalledAllele(AlleleCategory.Deletion)
{
Coordinate = 107,
Reference = "ATTT",
Alternate = "A",
Chromosome = "chr7"
}
};
functionalTestRunner.Execute(bamFilePath, Path.ChangeExtension(bamFilePath, "genome.vcf"), null, expectedAlleles, mockChrRef, applicationOptions: appOptions);
}