public void TryReStitch_RealCases()
{
var read1 = TestHelpers.CreateRead("chr1", "AGCAGCAGCAGCTCCAGCACCAGCAGTCCCAGCACCAGCAGGCCCCGAAGAAGCATACCCAGCAGCAGAAGACACCTCAGCAGCTGCACCAGGTGATCGG", 14106298,
new CigarAlignment("41M59S"));
var read2 = TestHelpers.CreateRead("chr1", "GCGATCTATCAGTATTAGCTCCAGCATCAGCAGCCCGAGCATCTGCAGTTCTAGCAGCAGCAGTCCCAGCAGCAGCAGTCCCAGCAGCAGCTGCCCCAGT", 14106328,
new CigarAlignment("52S48M"));
var stitcher = new BasicStitcher(20, false,
true, debug: false, nifyUnstitchablePairs: true, ignoreProbeSoftclips: true, maxReadLength: 1024, ignoreReadsAboveMaxLength: false, thresholdNumDisagreeingBases: 1000);
var stitchedPairHandler = new PairHandler(new Dictionary <int, string>()
{
{ 1, "chr1" }
}, stitcher, tryStitch: true);
var restitcher = new PostRealignmentStitcher(stitchedPairHandler, new Mock <IStatusHandler>().Object);
var pair = new ReadPair(read1.BamAlignment);
pair.AddAlignment(read2.BamAlignment);
var mockNmCalculator = new Mock <INmCalculator>();
var reads = restitcher.GetRestitchedReads(pair, pair.Read1, pair.Read2, 1, 1, false, mockNmCalculator.Object, false);
Assert.Equal(1.0, reads.Count);
Assert.Equal("22S78M22S", reads.First().CigarData.ToString());
}
public void Restitch()
{
var stitchedPairHandler = new PairHandler(new Dictionary <int, string>()
{
{ 1, "chr1" }
}, new BasicStitcher(5), tryStitch: true);
var restitcher = new PostRealignmentStitcher(stitchedPairHandler, new Mock <IStatusHandler>().Object);
var mockNmCalculator = new Mock <INmCalculator>();
var pair = TestHelpers.GetPair("3M1I4M", "3M1I4M");
var reads = restitcher.GetRestitchedReads(pair, pair.Read1, pair.Read2, 0, 0, true, mockNmCalculator.Object, false);
Assert.Equal(1.0, reads.Count);
Assert.Equal("3M1I4M", reads.First().CigarData.ToString());
pair = TestHelpers.GetPair("3M1I4M", "3M5S");
reads = restitcher.GetRestitchedReads(pair, pair.Read1, pair.Read2, 0, 0, true, mockNmCalculator.Object, false);
Assert.Equal(1.0, reads.Count);
Assert.Equal("3M1I4M", reads.First().CigarData.ToString());
pair = TestHelpers.GetPair("3M2I4M", "3M1I");
reads = restitcher.GetRestitchedReads(pair, pair.Read1, pair.Read2, 0, 0, true, mockNmCalculator.Object, false);
Assert.Equal(1, reads.Count);
Assert.Equal("3M2I4M", reads.First().CigarData.ToString());
// Second read insertion is longer, can't stitch
pair = TestHelpers.GetPair("3M2I4M", "3M3I");
reads = restitcher.GetRestitchedReads(pair, pair.Read1, pair.Read2, 0, 0, true, mockNmCalculator.Object, false);
Assert.Equal(2, reads.Count);
Assert.Equal("3M2I4M", reads[0].CigarData.ToString());
Assert.Equal("3M3I", reads[1].CigarData.ToString());
// Same insertion introduced. One read had NM=4 before (included insertion), other did not. Stitched NM is 4 (3 from the insertion, 1 from the mismatch in the original read)
pair = TestHelpers.GetPair("3M3I4M", "3M3I6M");
mockNmCalculator.Setup(x => x.GetNm(It.IsAny <BamAlignment>())).Returns(4);
reads = restitcher.GetRestitchedReads(pair, pair.Read1, pair.Read2, 0, 4, true, mockNmCalculator.Object, true);
Assert.Equal(1, reads.Count);
Assert.Equal("3M3I6M", reads[0].CigarData.ToString());
// Same insertion introduced. One read had NM=4 before (included insertion), other did not (was perfect).
// Stitched NM is 5 (3 from the insertion, 1 from the mismatch in the original read, and, say, 1 from a mismatch introduced by realignment in the first read)
pair = TestHelpers.GetPair("3M3I4M", "3M3I6M");
mockNmCalculator.Setup(x => x.GetNm(It.IsAny <BamAlignment>())).Returns(5);
reads = restitcher.GetRestitchedReads(pair, pair.Read1, pair.Read2, 0, 4, true, mockNmCalculator.Object, true);
Assert.Equal(2, reads.Count);
// Partial insertion, from right
pair = TestHelpers.GetPair("3M2I4M", "1I4M", read2Offset: 3);
reads = restitcher.GetRestitchedReads(pair, pair.Read1, pair.Read2, 0, 0, true, mockNmCalculator.Object, false);
Assert.Equal(1, reads.Count);
Assert.Equal("3M2I4M", reads.First().CigarData.ToString());
}
private static List <BamAlignment> ExtractReadsFromRealignerAndCombiner(PairResult pair, string refSeq,
int refSeqOffset, List <PreIndel> preIndels, bool hasExistingIndels = false)
{
var stitchedPairHandler =
new PairHandler(new Dictionary <int, string>()
{
{ 1, "chr1" }
}, new BasicStitcher(0), tryStitch: true);
var snippetSource = new Mock <IGenomeSnippetSource>();
var genomeSnippet = new GenomeSnippet()
{
Chromosome = "chr1",
Sequence = new string('A', refSeqOffset) + refSeq + new string('T', 1000),
StartPosition = 0
};
snippetSource.Setup(x => x.GetGenomeSnippet(It.IsAny <int>())).Returns(genomeSnippet);
var mockStatusHandler = new Mock <IStatusHandler>();
var comparer = new GemBasicAlignmentComparer(false, false);
var readRealigner = new GeminiReadRealigner(comparer, remaskSoftclips: false,
keepProbeSoftclips: false, keepBothSideSoftclips: false,
trackActualMismatches: false, checkSoftclipsForMismatches: true,
debug: false, maskNsOnly: false, maskPartialInsertion: false,
minimumUnanchoredInsertionLength: 1,
minInsertionSizeToAllowMismatchingBases: 4,
maxProportionInsertSequenceMismatch: 0.2); // TODO fix // TODO figure out what I was saying to fix here...
var filterer = new Mock <IRegionFilterer>();
filterer.Setup(x => x.AnyIndelsNearby(It.IsAny <int>())).Returns(true);
var indels = preIndels.Select(x => HashableIndelSource.GetHashableIndel(genomeSnippet, x, 0, false)).ToList();
var indelSource = new ChromosomeIndelSource(indels, snippetSource.Object);
var realignmentEvaluator = new RealignmentEvaluator(indelSource, mockStatusHandler.Object, readRealigner,
new RealignmentJudger(comparer), "chr1", false, true, true, true, filterer.Object, false);
var combiner = new ReadPairRealignerAndCombiner(new NonSnowballEvidenceCollector(),
new PostRealignmentStitcher(stitchedPairHandler, new DebugStatusHandler(new ReadStatusCounter())),
realignmentEvaluator, new PairSpecificIndelFinder(), "chr1", false, hasExistingIndels: hasExistingIndels);
var nmCalc = new NmCalculator(snippetSource.Object);
var result = combiner.ExtractReads(pair, nmCalc);
return(result);
}
public void RankPlayers(List <PlayerHand> players)
{
StraightFlushHandler straightFlushHandler = new StraightFlushHandler();
ThreeofKindHandler threeofKindHandler = new ThreeofKindHandler();
StraightFlushHandler straightFlushHandler1 = new StraightFlushHandler();
FlushHandler flushHandler = new FlushHandler();
PairHandler pairHandler = new PairHandler();
straightFlushHandler.SetNextHandler(threeofKindHandler);
threeofKindHandler.SetNextHandler(straightFlushHandler);
straightFlushHandler.SetNextHandler(flushHandler);
flushHandler.SetNextHandler(pairHandler);
foreach (var player in players)
{
straightFlushHandler.Process(player);
}
}
public ReadPairRealignerAndCombiner GetRealignPairHandler(bool tryRestitch, bool alreadyStitched,
bool pairAwareRealign,
Dictionary <int, string> refIdMapping, ReadStatusCounter statusCounter, bool isSnowball,
IChromosomeIndelSource indelSource, string chromosome, Dictionary <string, IndelEvidence> masterLookup,
bool hasIndels, Dictionary <HashableIndel, int[]> outcomesLookup, bool skipRestitchIfNothingChanged)
{
var stitcher = GetStitcher();
var stitchedPairHandler = new PairHandler(refIdMapping, stitcher, tryStitch: tryRestitch);
var judger = new RealignmentJudger(GetAlignmentComparer());
var readRealigner = new GeminiReadRealigner(GetAlignmentComparer(), remaskSoftclips: _geminiOptions.RemaskMessySoftclips,
keepProbeSoftclips: _geminiOptions.KeepProbeSoftclip, keepBothSideSoftclips: _geminiOptions.KeepBothSideSoftclips || (_geminiOptions.KeepProbeSoftclip && alreadyStitched),
trackActualMismatches: _realignmentAssessmentOptions.TrackActualMismatches, checkSoftclipsForMismatches: _realignmentAssessmentOptions.CheckSoftclipsForMismatches,
debug: _geminiOptions.Debug, maskNsOnly: !(_geminiOptions.RemaskMessySoftclips || _geminiOptions.KeepProbeSoftclip || _geminiOptions.KeepBothSideSoftclips), maskPartialInsertion: _realignmentOptions.MaskPartialInsertion,
minimumUnanchoredInsertionLength: _realignmentOptions.MinimumUnanchoredInsertionLength,
minInsertionSizeToAllowMismatchingBases: 4, maxProportionInsertSequenceMismatch: 0.2); // TODO fix // TODO figure out what I was saying to fix here...
IStatusHandler statusHandler = new DebugSummaryStatusHandler(statusCounter);
if (_geminiOptions.Debug)
{
statusHandler = new DebugStatusHandler(statusCounter);
}
// Only softclip unknowns if it is not stitched to begin with (we believe in these more, plus it makes our lives simpler for dealing with stitched directions)
var softclipUnknownIndels = _geminiOptions.SoftclipUnknownIndels && !alreadyStitched;
//var regionFilterer = new RegionFilterer(chromosome, indelSource.Indels);
var regionFilterer = new DummyRegionFilterer();
var collector = GetCollector(isSnowball);
var realignmentEvaluator = new RealignmentEvaluator(indelSource.DeepCopy(), statusHandler, readRealigner, judger, chromosome,
_realignmentAssessmentOptions.TrackActualMismatches, _realignmentAssessmentOptions.CheckSoftclipsForMismatches, _geminiOptions.AllowRescoringOrigZero, softclipUnknownIndels,
regionFilterer, _geminiOptions.LightDebug);
return(new ReadPairRealignerAndCombiner(
collector,
GetRestitcher(stitchedPairHandler, statusHandler),
realignmentEvaluator,
GetIndelFinder(pairAwareRealign, chromosome, indelSource), chromosome, alreadyStitched, pairAwareRealign,
masterLookup: masterLookup, hasExistingIndels: hasIndels,
masterOutcomesLookup: outcomesLookup, skipRestitchIfNothingChanged: skipRestitchIfNothingChanged, allowedToStitch: !_geminiOptions.SkipStitching));
}
private IReadRestitcher GetRestitcher(PairHandler pairHandler, IStatusHandler statusHandler)
{
// TODO also allow not restitch
return(new PostRealignmentStitcher(pairHandler, statusHandler, _stitcherOptions.StringTagsToKeepFromR1));
}
private void ExtractReads(bool addUmiTags)
{
var refIdMapping = new Dictionary <int, string>()
{
{ 1, "chr1" }
};
var stitcher = StitcherTestHelpers.GetStitcher(10, false);
var readStatusCounter = new ReadStatusCounter();
var pairHandler = new PairHandler(refIdMapping, stitcher, readStatusCounter, filterUnstitchablePairs: true);
var alignment1 = new BamAlignment()
{
AlignmentFlag = 0,
Bases = "ABCF",
Bin = 4,
CigarData = new CigarAlignment("2S2M"),
FragmentLength = 42,
MapQuality = 30,
MatePosition = 2,
MateRefID = 43,
Name = "Read1",
Position = 1,
Qualities = new byte[4],
RefID = 1,
TagData = new byte[0]
};
var tagUtils = new TagUtils();
tagUtils.AddStringTag("BC", "14");
tagUtils.AddIntTag("SM", 40);
if (addUmiTags)
{
tagUtils.AddIntTag("XV", 1);
tagUtils.AddIntTag("XW", 2);
tagUtils.AddStringTag("XU", "ABBA-ZABBA");
}
alignment1.AppendTagData(tagUtils.ToBytes());
var alignment2 = new BamAlignment()
{
AlignmentFlag = 0,
Bases = "ABCF",
Bin = 4,
CigarData = new CigarAlignment("2S2M"),
FragmentLength = 42,
MapQuality = 30,
MatePosition = 2,
MateRefID = 43,
Name = "Read1",
Position = 1,
Qualities = new byte[4],
RefID = 1,
TagData = new byte[0]
};
var tagUtils2 = new TagUtils();
tagUtils2.AddIntTag("NM", 5);
tagUtils2.AddStringTag("BC", "14");
tagUtils2.AddIntTag("SM", 20);
if (addUmiTags)
{
tagUtils2.AddIntTag("XV", 1);
tagUtils2.AddIntTag("XW", 2);
tagUtils2.AddStringTag("XU", "ABBA-ZABBA");
}
alignment2.AppendTagData(tagUtils2.ToBytes());
var readPair = new ReadPair(alignment1);
readPair.AddAlignment(alignment2);
var alignmentResults = pairHandler.ExtractReads(readPair);
Assert.Equal(1, alignmentResults.Count);
var alignment = alignmentResults[0];
Assert.NotNull(alignment.GetStringTag("XD"));
Assert.Null(alignment.GetIntTag("NM"));
Assert.Null(alignment.GetStringTag("BC"));
Assert.Null(alignment.GetIntTag("SM"));
if (addUmiTags)
{
Assert.Equal("ABBA-ZABBA", alignment.GetStringTag("XU"));
Assert.Equal(1, alignment.GetIntTag("XV"));
Assert.Equal(2, alignment.GetIntTag("XW"));
}
}
private void ExtractReadsStrand(bool r1Reverse, bool r2Reverse, string expectedXRTag)
{
var refIdMapping = new Dictionary <int, string>()
{
{ 1, "chr1" }
};
var stitcher = StitcherTestHelpers.GetStitcher(10, false);
var readStatusCounter = new ReadStatusCounter();
var pairHandler = new PairHandler(refIdMapping, stitcher, readStatusCounter, filterUnstitchablePairs: true);
var alignment1 = new BamAlignment()
{
AlignmentFlag = 0,
Bases = "ABCF",
Bin = 4,
CigarData = new CigarAlignment("2S2M"),
FragmentLength = 42,
MapQuality = 30,
MatePosition = 2,
MateRefID = 43,
Name = "Read1",
Position = 1,
Qualities = new byte[4],
RefID = 1,
TagData = new byte[0]
};
alignment1.SetIsFirstMate(true);
alignment1.SetIsReverseStrand(r1Reverse);
var alignment2 = new BamAlignment()
{
AlignmentFlag = 0,
Bases = "ABCF",
Bin = 4,
CigarData = new CigarAlignment("2S2M"),
FragmentLength = 42,
MapQuality = 30,
MatePosition = 2,
MateRefID = 43,
Name = "Read1",
Position = 1,
Qualities = new byte[4],
RefID = 1,
TagData = new byte[0]
};
alignment2.SetIsSecondMate(true);
alignment2.SetIsReverseStrand(r2Reverse);
var readPair = new ReadPair(alignment1);
readPair.AddAlignment(alignment2);
var alignmentResults = pairHandler.ExtractReads(readPair);
Assert.Equal(1, alignmentResults.Count);
var alignment = alignmentResults[0];
var XD = alignment.GetStringTag("XR");
Assert.Equal(expectedXRTag, alignment.GetStringTag("XR"));
}
private void ExtractReadsStrandXRValidation()
{
var refIdMapping = new Dictionary <int, string>()
{
{ 1, "chr1" }
};
var stitcher = StitcherTestHelpers.GetStitcher(10, false);
var readStatusCounter = new ReadStatusCounter();
var pairHandler = new PairHandler(refIdMapping, stitcher, readStatusCounter, filterUnstitchablePairs: true);
var alignment1 = new BamAlignment()
{
AlignmentFlag = 99,
Bases = "ABCF",
Bin = 4,
CigarData = new CigarAlignment("2S2M"),
FragmentLength = 42,
MapQuality = 30,
MatePosition = 2,
MateRefID = 43,
Name = "Read1",
Position = 1,
Qualities = new byte[4],
RefID = 1,
TagData = new byte[0]
};
var tagUtils = new TagUtils();
tagUtils.AddStringTag("XR", "BLABLA"); //start with random XR tag and confirm whether it is overwritten by read direction
alignment1.AppendTagData(tagUtils.ToBytes());
var alignment2 = new BamAlignment()
{
AlignmentFlag = 144,
Bases = "ABCF",
Bin = 4,
CigarData = new CigarAlignment("2S2M"),
FragmentLength = 42,
MapQuality = 30,
MatePosition = 2,
MateRefID = 43,
Name = "Read1",
Position = 1,
Qualities = new byte[4],
RefID = 1,
TagData = new byte[0]
};
var tagUtils2 = new TagUtils();
tagUtils.AddStringTag("XR", "BLABLA"); //start with random XR tag and confirm whether it is overwritten by read direction
alignment2.AppendTagData(tagUtils.ToBytes());
var readPair = new ReadPair(alignment1);
readPair.AddAlignment(alignment2);
var alignmentResults = pairHandler.ExtractReads(readPair);
Assert.Equal(1, alignmentResults.Count);
var alignment = alignmentResults[0];
Assert.Equal("FR", alignment.GetStringTag("XR"));
}
