public void AddAndGetAlleleCounts() { var anchorSize = 5; var wellAnchoredIndex = anchorSize; var testRegion = new MyRegionState(1000, 2000, anchorSize); for (var i = 0; i < 5; i++) { testRegion.AddAlleleCount(1001, AlleleType.A, DirectionType.Forward, wellAnchoredIndex); } for (var i = 0; i < 2; i++) { testRegion.AddAlleleCount(1001, AlleleType.C, DirectionType.Forward, wellAnchoredIndex); } for (var i = 0; i < 12; i++) { testRegion.AddAlleleCount(1001, AlleleType.C, DirectionType.Reverse, wellAnchoredIndex); } for (var i = 0; i < 15; i++) { testRegion.AddAlleleCount(2000, AlleleType.A, DirectionType.Stitched, wellAnchoredIndex); } Assert.Equal(testRegion.GetAlleleCount(1001, AlleleType.A, DirectionType.Forward), 5); Assert.Equal(testRegion.GetAlleleCount(1001, AlleleType.C, DirectionType.Forward), 2); Assert.Equal(testRegion.GetAlleleCount(1001, AlleleType.C, DirectionType.Reverse), 12); Assert.Equal(testRegion.GetAlleleCount(2000, AlleleType.A, DirectionType.Stitched), 15); Assert.Equal(testRegion.GetAlleleCount(1000, AlleleType.A, DirectionType.Stitched), 0); Assert.Equal(testRegion.GetAlleleCount(1500, AlleleType.A, DirectionType.Forward), 0); }
public void AddAndGetCandidates_Errors() { var testRegion = new MyRegionState(1000, 2000); Assert.Throws <ArgumentException>( () => testRegion.AddCandidate(new CandidateAllele("chr1", 999, "A", "T", AlleleCategory.Snv))); Assert.Throws <ArgumentException>( () => testRegion.GetAlleleCount(2001, AlleleType.A, DirectionType.Forward)); }
private List <int> GetAllRefCounts(MyRegionState testRegion) { var refCounts = new List <int>(); for (int position = testRegion.StartPosition; position <= testRegion.EndPosition; position++) { refCounts.Add(testRegion.GetGappedMnvRefCount(position)); } return(refCounts); }
public void Equality() { // happy path var testRegion = new MyRegionState(1500, 7002); var otherRegion = new MyRegionState(1500, 7002); Assert.True(testRegion.Equals(otherRegion)); Assert.True(otherRegion.Equals(testRegion)); // error conditions otherRegion = new MyRegionState(1501, 7002); // diff start Assert.False(testRegion.Equals(otherRegion)); otherRegion = new MyRegionState(1500, 7001); // diff end Assert.False(testRegion.Equals(otherRegion)); Assert.False(testRegion.Equals("otherobject")); }
public void ForcedAllelesShouldBeCandidateAllelesForVcf() { var testRegion = new MyRegionState(10, 15); var myChrRef = new ChrReference() { Name = "chr1", Sequence = "ATGGCCTACGATTAGTAGGT" }; HashSet <Tuple <string, int, string, string> > forcedAlleles = new HashSet <Tuple <string, int, string, string> > { new Tuple <string, int, string, string>("chr1", 12, "T", "C"), new Tuple <string, int, string, string>("chr1", 12, "T", "A") }; var observedCandidateAllele = testRegion.GetAllCandidates(false, myChrRef, null, forcedAlleles); Assert.Equal(2, observedCandidateAllele.Count); var allele1 = observedCandidateAllele.First(); Assert.Equal(AlleleCategory.Reference, allele1.Type); }
public void AddAndGetGappedMnvReferenceCounts_Errors() { var testRegion = new MyRegionState(50, 150); testRegion.AddGappedMnvRefCount(150, 10); var refCountsBefore = GetAllRefCounts(testRegion); // ----------------------------------------------- // adding at an invalid position should do nothing // ----------------------------------------------- testRegion.AddGappedMnvRefCount(151, 1); var refCountsAfter = GetAllRefCounts(testRegion); Assert.True(refCountsAfter.SequenceEqual(refCountsBefore)); // ----------------------------------------------- // getting at an invalid position should throw exception // ----------------------------------------------- Assert.Throws <ArgumentException>(() => testRegion.GetGappedMnvRefCount(151)); }
public void AddAndGetGappedMnvReferenceCounts() { var testRegion = new MyRegionState(50, 150); // ----------------------------------------------- // happy path - add a couple of counts, // getting them should return the same // ----------------------------------------------- testRegion.AddGappedMnvRefCount(75, 1); testRegion.AddGappedMnvRefCount(76, 10); Assert.Equal(1, testRegion.GetGappedMnvRefCount(75)); Assert.Equal(10, testRegion.GetGappedMnvRefCount(76)); // ----------------------------------------------- // happy path - add a couple of counts to existing ref, // it should be incremented but others should be unchanged // ----------------------------------------------- testRegion.AddGappedMnvRefCount(76, 3); Assert.Equal(1, testRegion.GetGappedMnvRefCount(75)); Assert.Equal(13, testRegion.GetGappedMnvRefCount(76)); }
public void ForceAlleleNotBeReportedWhenOutOfInterval() { var testRegion = new MyRegionState(10, 15); var myChrRef = new ChrReference() { Name = "chr1", Sequence = "ATGGCCTACGATTAGTAGGT" }; HashSet <Tuple <string, int, string, string> > forcedAlleles = new HashSet <Tuple <string, int, string, string> > { new Tuple <string, int, string, string>("chr1", 12, "T", "C"), new Tuple <string, int, string, string>("chr1", 12, "T", "A") }; var myIntervals = new ChrIntervalSet(new List <Region> { new Region(13, 15) }, "chr1"); var observedCandidateAllele = testRegion.GetAllCandidates(true, myChrRef, myIntervals, forcedAlleles); Assert.Equal(3, observedCandidateAllele.Count); Assert.True(observedCandidateAllele.All(x => x.ReferencePosition > 12)); }
public void ExecuteTest_GetCandidates(bool withReference, bool withIntervals) { var anchorSize = 5; var wellAnchoredIndex = anchorSize; var testRegion = new MyRegionState(1, 50); var chrReference = new ChrReference() { Name = "chr1", Sequence = string.Concat(Enumerable.Repeat("A", 50)) }; var snv1 = new CandidateAllele("chr1", 5, "A", "T", AlleleCategory.Snv) { SupportByDirection = new[] { 10, 5, 0 } }; var snv2 = new CandidateAllele("chr1", 15, "A", "T", AlleleCategory.Snv) { SupportByDirection = new[] { 10, 5, 0 } }; testRegion.AddCandidate(snv1); testRegion.AddCandidate(snv2); for (var i = 0; i < 5; i++) { testRegion.AddAlleleCount(5, AlleleType.A, DirectionType.Stitched, wellAnchoredIndex); // ref @ variant position testRegion.AddAlleleCount(6, AlleleType.A, DirectionType.Stitched, wellAnchoredIndex); // ref by itself testRegion.AddAlleleCount(10, AlleleType.C, DirectionType.Stitched, wellAnchoredIndex); // nonref by itself (no ref) testRegion.AddAlleleCount(15, AlleleType.A, DirectionType.Reverse, wellAnchoredIndex); // ref (multiple directions) + nonref testRegion.AddAlleleCount(15, AlleleType.A, DirectionType.Forward, wellAnchoredIndex); testRegion.AddAlleleCount(15, AlleleType.T, DirectionType.Reverse, wellAnchoredIndex); } ChrIntervalSet intervals = null; if (withIntervals) { intervals = new ChrIntervalSet(new List <Region>() { new Region(3, 6), new Region(16, 16) }, "chr1"); } var expectedList = new List <CandidateAllele>(); expectedList.Add(snv1); expectedList.Add(snv2); if (withReference) { expectedList.Add(new CandidateAllele("chr1", 5, "A", "A", AlleleCategory.Reference) { SupportByDirection = new[] { 0, 0, 5 } }); expectedList.Add(new CandidateAllele("chr1", 6, "A", "A", AlleleCategory.Reference) { SupportByDirection = new[] { 0, 0, 5 } }); expectedList.Add(new CandidateAllele("chr1", 10, "A", "A", AlleleCategory.Reference) { SupportByDirection = new[] { 0, 0, 0 } }); expectedList.Add(new CandidateAllele("chr1", 15, "A", "A", AlleleCategory.Reference) { SupportByDirection = new[] { 5, 5, 0 } }); } if (withIntervals) { expectedList = expectedList.Where(c => c.ReferencePosition == 5 || c.ReferencePosition == 6 || c.Type != AlleleCategory.Reference).ToList(); if (withReference) { expectedList.Add(new CandidateAllele("chr1", 3, "A", "A", AlleleCategory.Reference) { SupportByDirection = new[] { 0, 0, 0 } }); expectedList.Add(new CandidateAllele("chr1", 4, "A", "A", AlleleCategory.Reference) { SupportByDirection = new[] { 0, 0, 0 } }); expectedList.Add(new CandidateAllele("chr1", 16, "A", "A", AlleleCategory.Reference) { SupportByDirection = new[] { 0, 0, 0 } }); } } var allCandidates = testRegion.GetAllCandidates(withReference, chrReference, intervals); VerifyCandidates(expectedList, allCandidates); }
public void AddAndGetCandidates() { // ----------------------------------------------- // simple test case adding candidate to empty region // ----------------------------------------------- var testRegion = new MyRegionState(1000, 2000); var snv1 = new CandidateAllele("chr1", 1500, "A", "T", AlleleCategory.Snv) { SupportByDirection = new[] { 10, 0, 0 } }; testRegion.AddCandidate(snv1); var allCandidates = testRegion.GetAllCandidates(false, null); Assert.Equal(allCandidates.Count, 1); var fetchedCandidate = allCandidates[0]; Assert.True(fetchedCandidate.Equals(snv1)); // ----------------------------------------------- // add same type of candidate but at different position // ----------------------------------------------- var snv2 = new CandidateAllele("chr1", 1501, "A", "T", AlleleCategory.Snv) { SupportByDirection = new[] { 5, 0, 0 } }; testRegion.AddCandidate(snv2); allCandidates = testRegion.GetAllCandidates(false, null); Assert.Equal(allCandidates.Count, 2); // make sure coverage is preserved fetchedCandidate = allCandidates.FirstOrDefault(c => c.Equals(snv1)); Assert.True(fetchedCandidate != null && fetchedCandidate.Support == 10); fetchedCandidate = allCandidates.FirstOrDefault(c => c.Equals(snv2)); Assert.True(fetchedCandidate != null && fetchedCandidate.Support == 5); // ----------------------------------------------- // add a different type of candidate at same position // ----------------------------------------------- var deletion1 = new CandidateAllele("chr1", 1500, "AT", "A", AlleleCategory.Deletion) { SupportByDirection = new[] { 15, 0, 0 } }; testRegion.AddCandidate(deletion1); allCandidates = testRegion.GetAllCandidates(false, null); Assert.Equal(allCandidates.Count, 3); // make sure coverage is preserved fetchedCandidate = allCandidates.FirstOrDefault(c => c.Equals(snv1)); Assert.True(fetchedCandidate != null && fetchedCandidate.Support == 10); fetchedCandidate = allCandidates.FirstOrDefault(c => c.Equals(snv2)); Assert.True(fetchedCandidate != null && fetchedCandidate.Support == 5); fetchedCandidate = allCandidates.FirstOrDefault(c => c.Equals(deletion1)); Assert.True(fetchedCandidate != null && fetchedCandidate.Support == 15); // ----------------------------------------------- // add same variant, but more coverage // ----------------------------------------------- var moreSnv1 = new CandidateAllele("chr1", 1500, "A", "T", AlleleCategory.Snv) { SupportByDirection = new[] { 2, 0, 0 }, ReadCollapsedCountsMut = new[] { 9, 8, 7, 6, 0, 0, 0, 0 } }; testRegion.AddCandidate(moreSnv1); allCandidates = testRegion.GetAllCandidates(false, null); Assert.Equal(allCandidates.Count, 3); // make sure coverage is incremented, read counts incremented fetchedCandidate = allCandidates.FirstOrDefault(c => c.Equals(snv1)); Assert.True(fetchedCandidate != null && fetchedCandidate.Support == 12); for (var i = 0; i < Constants.NumReadCollapsedTypes; i++) { Assert.True(fetchedCandidate != null && fetchedCandidate.ReadCollapsedCountsMut[i] == moreSnv1.ReadCollapsedCountsMut[i]); } // make sure coverage is preserved, read counts preserved fetchedCandidate = allCandidates.FirstOrDefault(c => c.Equals(snv2)); Assert.True(fetchedCandidate != null && fetchedCandidate.Support == 5); for (var i = 0; i < Constants.NumReadCollapsedTypes; i++) { Assert.True(fetchedCandidate != null && fetchedCandidate.ReadCollapsedCountsMut[i] == 0); } fetchedCandidate = allCandidates.FirstOrDefault(c => c.Equals(deletion1)); Assert.True(fetchedCandidate != null && fetchedCandidate.Support == 15); for (var i = 0; i < Constants.NumReadCollapsedTypes; i++) { Assert.True(fetchedCandidate != null && fetchedCandidate.ReadCollapsedCountsMut[i] == 0); } var moreDeletion1 = new CandidateAllele("chr1", 1500, "AT", "A", AlleleCategory.Deletion) { SupportByDirection = new[] { 0, 18, 0 } }; testRegion.AddCandidate(moreDeletion1); allCandidates = testRegion.GetAllCandidates(false, null); Assert.Equal(allCandidates.Count, 3); // make sure coverage is incremented fetchedCandidate = allCandidates.FirstOrDefault(c => c.Equals(deletion1)); Assert.True(fetchedCandidate != null && fetchedCandidate.Support == 33); // make sure coverage is preserved fetchedCandidate = allCandidates.FirstOrDefault(c => c.Equals(snv1)); Assert.True(fetchedCandidate != null && fetchedCandidate.Support == 12); fetchedCandidate = allCandidates.FirstOrDefault(c => c.Equals(snv2)); Assert.True(fetchedCandidate != null && fetchedCandidate.Support == 5); // ----------------------------------------------- // add insertion that goes off block // ----------------------------------------------- var edgeInsertion = new CandidateAllele("chr1", 2000, "A", "TCG", AlleleCategory.Insertion) { SupportByDirection = new[] { 5, 0, 0 } }; testRegion.AddCandidate(edgeInsertion); allCandidates = testRegion.GetAllCandidates(false, null); Assert.Equal(allCandidates.Count, 4); Assert.Equal(2001, testRegion.MaxAlleleEndpoint); // ----------------------------------------------- // add mnv that goes off block // ----------------------------------------------- var edgeMnv = new CandidateAllele("chr1", 1999, "ATCC", "TCGG", AlleleCategory.Mnv) { SupportByDirection = new[] { 5, 0, 0 } }; testRegion.AddCandidate(edgeMnv); allCandidates = testRegion.GetAllCandidates(false, null); Assert.Equal(allCandidates.Count, 5); Assert.Equal(2002, testRegion.MaxAlleleEndpoint); // ----------------------------------------------- // add deletion that goes off block // ----------------------------------------------- var edgeDeletion = new CandidateAllele("chr1", 1999, "A" + new string('T', 25), "A", AlleleCategory.Deletion) { SupportByDirection = new[] { 5, 0, 0 } }; testRegion.AddCandidate(edgeDeletion); allCandidates = testRegion.GetAllCandidates(false, null); Assert.Equal(allCandidates.Count, 6); Assert.Equal(2025, testRegion.MaxAlleleEndpoint); // ----------------------------------------------- // add variant that goes off block but not as far as the deletion did - max endpoint should stay the same // ----------------------------------------------- var edgeMnv2 = new CandidateAllele("chr1", 1999, "ATCGA", "TCGCT", AlleleCategory.Mnv) { SupportByDirection = new[] { 5, 0, 0 } }; testRegion.AddCandidate(edgeMnv2); allCandidates = testRegion.GetAllCandidates(false, null); Assert.Equal(allCandidates.Count, 7); Assert.Equal(2025, testRegion.MaxAlleleEndpoint); // ----------------------------------------------- // add candidate group // ----------------------------------------------- var candidateGroupAdd1 = new List <CandidateAllele>() { snv1, snv2 }; var candidateGroupAdd2 = new List <CandidateAllele>() { deletion1, edgeDeletion }; var candidateGroupAdd3 = new List <CandidateAllele>() { edgeMnv, edgeInsertion, snv1 }; var candidateGroupAdd4 = new List <CandidateAllele>() { moreSnv1 }; // candidateGroupAdd5 has the same variants as candidateGroupAdd1. should not generate a new group var snv1Duplicate = new CandidateAllele("chr1", 1500, "A", "T", AlleleCategory.Snv) { SupportByDirection = new[] { 10, 0, 0 } }; var candidateGroupAdd5 = new List <CandidateAllele>() { snv1Duplicate, snv2 }; var candidateGroupAdd = new List <List <CandidateAllele> >() { candidateGroupAdd1, candidateGroupAdd2, candidateGroupAdd3, candidateGroupAdd4, candidateGroupAdd5 }; foreach (var candidate in candidateGroupAdd) { testRegion.AddCandidateGroup(candidate); } testRegion.AddCandidateGroup(candidateGroupAdd1); var candidateGroupGet = testRegion.GetBlockCandidateGroup(); Assert.Equal(candidateGroupGet.Count, 5); Assert.True(candidateGroupGet.Contains(new Tuple <string, string, string>(snv1.ToString(), snv2.ToString(), null))); Assert.False(candidateGroupGet.Contains(new Tuple <string, string, string>(snv2.ToString(), snv1.ToString(), null))); Assert.True(candidateGroupGet.Contains(new Tuple <string, string, string>(deletion1.ToString(), edgeDeletion.ToString(), null))); Assert.True(candidateGroupGet.Contains(new Tuple <string, string, string>(snv1.ToString(), edgeMnv.ToString(), edgeInsertion.ToString()))); Assert.True(candidateGroupGet.Contains(new Tuple <string, string, string>(snv1.ToString(), edgeMnv.ToString(), null))); Assert.True(candidateGroupGet.Contains(new Tuple <string, string, string>(edgeMnv.ToString(), edgeInsertion.ToString(), null))); Assert.False(candidateGroupGet.Contains(new Tuple <string, string, string>(edgeMnv.ToString(), snv1.ToString(), edgeInsertion.ToString()))); Assert.False(candidateGroupGet.Contains(new Tuple <string, string, string>(snv1.ToString(), edgeInsertion.ToString(), null))); }