public void TryStitch_NoXC_Stitchable() { //Reads without XC tags that do overlap should be added as one merged read in basic stitcher var basicStitcher = StitcherTestHelpers.GetStitcher(10); var alignmentSet = StitcherTestHelpers.GetOverlappingReadSet(); basicStitcher.TryStitch(alignmentSet); Assert.Equal(1, alignmentSet.ReadsForProcessing.Count); }
public void TryStitch_NoXC_Stitchable() { var xcStitcherXcRequired = GetXCStitcher(); //Reads without XC tags that do overlap should be added separately in XC stitcher when xc is required var alignmentSet = StitcherTestHelpers.GetOverlappingReadSet(); StitcherTestHelpers.TryStitchAndAssertFailed(xcStitcherXcRequired, alignmentSet); }
public void TryStitch_NoXC_Unstitchable() { var read1 = TestHelper.CreateRead("chr1", "ATCGATCG", 12345, new CigarAlignment("8M"), qualityForAll: 30); var read2_noOverlap = TestHelper.CreateRead("chr1", "A", 2384, new CigarAlignment("1M"), qualityForAll: 30); var read2_overlap = TestHelper.CreateRead("chr1", "ATCGTT", 12349, new CigarAlignment("6M"), qualityForAll: 30); var read2_diffChrom = TestHelper.CreateRead("chr2", "ATCGTT", 12349, new CigarAlignment("6M"), qualityForAll: 30); var read2_nonOverlap_border = TestHelper.CreateRead("chr1", "AT", 12343, new CigarAlignment("2M"), qualityForAll: 30); var stitcher = StitcherTestHelpers.GetStitcher(10, true); // ----------------------------------------------- // Either of the partner reads is missing* // *(only read that could be missing is read 2, if read 1 was missing couldn't create alignment set) // ----------------------------------------------- // Should throw an exception var alignmentSet = new AlignmentSet(read1, null); Assert.Throws <ArgumentException>(() => stitcher.TryStitch(alignmentSet)); // ----------------------------------------------- // No overlap, reads are far away // ----------------------------------------------- // Shouldn't stitch alignmentSet = new AlignmentSet(read1, read2_noOverlap); StitcherTestHelpers.TryStitchAndAssertFailed(stitcher, alignmentSet); // ----------------------------------------------- // No overlap, reads are directly neighboring // ----------------------------------------------- // Shouldn't stitch alignmentSet = new AlignmentSet(read1, read2_nonOverlap_border); StitcherTestHelpers.TryStitchAndAssertFailed(stitcher, alignmentSet); // ----------------------------------------------- // No overlap, reads on diff chromosomes // ----------------------------------------------- // Should throw exception alignmentSet = new AlignmentSet(read1, read2_diffChrom); var ex = Assert.Throws <ArgumentException>(() => stitcher.TryStitch(alignmentSet)); Assert.Contains("Partner reads are from different chromosomes", ex.Message, StringComparison.InvariantCultureIgnoreCase); // This is brittle but since a variety of exceptions can happen in this process want to make sure it's this specific one }
public void TryStitch_CalculateStitchedCigar() { // ----------------------------------------------- // Read position maps disagree // ----------------------------------------------- // Should throw out the pair var read1 = TestHelper.CreateRead("chr1", "ATCGATCG", 12345, new CigarAlignment("2M2D3M1D3M"), qualityForAll: 30); //Within the overlap, we have a deletion so there will be a shifting of positions from that point on var read2 = TestHelper.CreateRead("chr1", "ATCGATCG", 12349, new CigarAlignment("8M"), qualityForAll: 30); var stitcher = StitcherTestHelpers.GetStitcher(10); var alignmentSet = new AlignmentSet(read1, read2); Assert.True(!alignmentSet.ReadsForProcessing.Any()); // ----------------------------------------------- // When calculating stitched cigar, stitched cigar should have // - everything from read1 before the overlap // - everything from read2 starting from the overlap // But since we ensure that the position maps agree in the overlap region, it's really not a matter of one taking precedence over the other // 1234... 1 - - 2 3 4 5 6 - - 7 8 9 0 // Read1 X X X X X X X X - - - - - // Read1 M I I M M M M M - - - - - // Read2 - - - X X X X X X X X - - // Read2 - - - M M M M M I M M - - // ----------------------------------------------- // Stitched cigar should have R1's insertion from before the overlap and R2's insertion from after the overlap read1 = TestHelper.CreateRead("chr1", "ATCGATCG", 12341, new CigarAlignment("1M2I5M"), qualityForAll: 30); read2 = TestHelper.CreateRead("chr1", "ATCGATCG", 12342, new CigarAlignment("5M1I2M"), qualityForAll: 30); stitcher = StitcherTestHelpers.GetStitcher(10); alignmentSet = new AlignmentSet(read1, read2); stitcher.TryStitch(alignmentSet); Assert.Equal("1M2I5M1I2M", StitcherTestHelpers.GetMergedRead(alignmentSet).CigarData.ToString()); }
public static void TestSuccesfullyStitchedRead(Read read1, Read read2, int minQscore, string xcTag, Action <Read> assertions) { var alignmentSet = new AlignmentSet(read1, read2); var stitcher = StitcherTestHelpers.GetStitcher(minQscore); stitcher.TryStitch(alignmentSet); // ----------------------------------------------- // Basic Stitcher, No XC tag // ----------------------------------------------- CheckMergedRead(xcTag, assertions, alignmentSet); // ----------------------------------------------- // XC Stitcher (XC Req), No XC tag // ----------------------------------------------- alignmentSet = new AlignmentSet(read1, read2); stitcher = StitcherTestHelpers.GetStitcher(minQscore, true); StitcherTestHelpers.TryStitchAndAssertFailed(stitcher, alignmentSet); // ----------------------------------------------- // Basic Stitcher, With XC tag // ----------------------------------------------- read1.StitchedCigar = new CigarAlignment(xcTag); read2.StitchedCigar = new CigarAlignment(xcTag); alignmentSet = new AlignmentSet(read1, read2); stitcher = StitcherTestHelpers.GetStitcher(minQscore); stitcher.TryStitch(alignmentSet); CheckMergedRead(xcTag, assertions, alignmentSet); // ----------------------------------------------- // XC Stitcher (XC Req), With XC tag // ----------------------------------------------- alignmentSet = new AlignmentSet(read1, read2); stitcher = StitcherTestHelpers.GetStitcher(minQscore, true); stitcher.TryStitch(alignmentSet); CheckMergedRead(xcTag, assertions, alignmentSet); }
public void TryStitch_CalculateStitchedCigar() { // ----------------------------------------------- // Read position maps disagree // ----------------------------------------------- var read1 = TestHelper.CreateRead("chr1", "ATCGATCG", 12345, new CigarAlignment("2M2D3M1D3M"), qualityForAll: 30); var read2 = TestHelper.CreateRead("chr1", "ATCGATCG", 12349, new CigarAlignment("8M"), qualityForAll: 30); // [If require XC] // We never calculate stitched cigar anyway. Bounce out to processing separately. var stitcher = GetXCStitcher(); var alignmentSet = new AlignmentSet(read1, read2); StitcherTestHelpers.TryStitchAndAssertFailed(stitcher, alignmentSet); // ----------------------------------------------- // When calculating stitched cigar, stitched cigar should have // - everything from read1 before the overlap // - everything from read2 starting from the overlap // But since we ensure that the position maps agree in the overlap region, it's really not a matter of one taking precedence over the other // 1234... 1 - - 2 3 4 5 6 - - 7 8 9 0 // Read1 X X X X X X X X - - - - - // Read1 M I I M M M M M - - - - - // Read2 - - - X X X X X X X X - - // Read2 - - - M M M M M I M M - - // ----------------------------------------------- // [If require XC] // No stitched cigar, and separate reads read1 = TestHelper.CreateRead("chr1", "ATCGATCG", 12341, new CigarAlignment("1M2I5M"), qualityForAll: 30); read2 = TestHelper.CreateRead("chr1", "ATCGATCG", 12342, new CigarAlignment("5M1I2M"), qualityForAll: 30); stitcher = GetXCStitcher(); alignmentSet = new AlignmentSet(read1, read2); StitcherTestHelpers.TryStitchAndAssertFailed(stitcher, alignmentSet); }
public void TryStitch_SoftclipScenarios() { //Migrated from old Pisces: Originally called CallSomaticVariants_MergeRead2First var sequence = "GGGGCCACGCGGGGAGCAGCCTCTGGCATTCTGGGAGCTTCATCTGGACCTGGGTCTTCAGTGAACCATTGTTCAATATCGTCCGGGGACAGCATCAAATCATCCATTGCTTGGGACGGCAAGGGGGACTGTAGATGGGTGAAAAGAGCA"; var read1 = TestHelper.CreateRead("chr1", sequence, 7579464, new CigarAlignment("2S122M26S"), Enumerable.Repeat((byte)30, sequence.Length).ToArray(), 7579464); StitcherTestHelpers.SetReadDirections(read1, DirectionType.Forward); sequence = "GTGTAGGAGCTGCTGGTGCAGGGGCCACGCGGGGAGCAGCCTCTGGCATTCTGGGAGCTTCATCTGGACCTGGGTCTTCAGTGAACAATTGTTCAATATCGTCCGGGGCCAGCATCAAATCATCCATTGCTTGGGACGGCAAGGGGGACT"; var read2 = TestHelper.CreateRead("chr1", sequence, 7579464, new CigarAlignment("22S122M6S"), Enumerable.Repeat((byte)30, sequence.Length).ToArray(), 7579464); StitcherTestHelpers.SetReadDirections(read2, DirectionType.Reverse); string expected = "GTGTAGGAGCTGCTGGTGCAGGGGCCACGCGGGGAGCAGCCTCTGGCATTCTGGGAGCTTCATCTGGACCTGGGTCTTCAGTGAACNATTGTTCAATATCGTCCGGGGNCAGCATCAAATCATCCATTGCTTGGGACGGCAAGGGGGACTGTAGATGGGTGAAAAGAGCA"; // both reads have the same reference position, but read2 really starts earlier // make sure we behave properly TestSuccesfullyStitchedRead(read1, read2, 0, "22S122M26S", (mergedRead) => { Assert.NotNull(mergedRead); Assert.Equal(mergedRead.Sequence, expected); }); }
public void TryStitch_ConsensusSequence() { // 1234... 1 - - 2 3 4 5 6 - - 7 8 9 0 //Reference Positions // Read1 X X X X X X X X - - - - - // Read1 M I I M M M M M - - - - - // Read1 A T C G A T C G - - - - - // Read2 - - - X X X X X X X X - - // Read2 - - - M M M M M I M M - - // Read2 - - - A T C G A T C G - - var r1qualities = 30; var r2qualities = 20; var read1 = TestHelper.CreateRead("chr1", "TTTTTTTT", 12341, new CigarAlignment("1M2I5M"), qualityForAll: (byte)r1qualities); var read2 = TestHelper.CreateRead("chr1", "AAAAAAAA", 12342, new CigarAlignment("5M1I2M"), qualityForAll: (byte)r2qualities); var stitcher = StitcherTestHelpers.GetStitcher(10); var alignmentSet = new AlignmentSet(read1, read2); stitcher.TryStitch(alignmentSet); // Merged A T C ? ? ? ? ? T C G - - // Merged M I I M M M M M I M M - - // Merged 0 1 2 3 4 5 6 7 8 9 0 1 2 var overlapStart = 3; var overlapEnd = 8; var overlapLength = 5; //Consensus sequence should have everything from read1 for positions before overlap var mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet); Assert.Equal("TTT", mergedRead.Sequence.Substring(0, overlapStart)); //Consensus sequence should have everything from read2 for positions after overlap Assert.Equal("AAA", mergedRead.Sequence.Substring(overlapEnd, 3)); //Consensus sequence should have an N where we have two high-quality (both above min) disagreeing bases Assert.Equal("NNNNN", mergedRead.Sequence.Substring(overlapStart, 5)); //Consensus sequence should have 0 quality where we have two high-quality (both above min) disagreeing bases Assert.True(mergedRead.Qualities.Take(overlapStart).All(q => q == r1qualities)); Assert.True(mergedRead.Qualities.Skip(overlapStart).Take(overlapLength).All(q => q == 0)); Assert.True(mergedRead.Qualities.Skip(overlapEnd).Take(mergedRead.Sequence.Length - overlapEnd).All(q => q == r2qualities)); //Consensus sequence should take higher quality base if one or more of the bases is below min quality //Read 2 trumps whole overlap read1.BamAlignment.Qualities = new byte[] { 30, 30, 30, 5, 5, 5, 5, 5 }; read2.BamAlignment.Qualities = new byte[] { 40, 40, 40, 40, 40, 20, 19, 18 }; alignmentSet = new AlignmentSet(read1, read2); stitcher.TryStitch(alignmentSet); mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet); Assert.Equal(read2.Sequence.Substring(0, 5), mergedRead.Sequence.Substring(overlapStart, 5)); Assert.Equal("TTTAAAAAAAA", mergedRead.Sequence); StitcherTestHelpers.CompareQuality(new byte[] { 30, 30, 30, 40, 40, 40, 40, 40, 20, 19, 18 }, mergedRead.Qualities); //Read 1 trumps whole overlap read1.BamAlignment.Qualities = new byte[] { 30, 30, 30, 40, 40, 40, 40, 40 }; read2.BamAlignment.Qualities = new byte[] { 5, 5, 5, 5, 5, 20, 19, 18 }; alignmentSet = new AlignmentSet(read1, read2); stitcher.TryStitch(alignmentSet); mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet); Assert.Equal(read1.Sequence.Substring(3, 5), mergedRead.Sequence.Substring(overlapStart, 5)); Assert.Equal("TTTTTTTTAAA", mergedRead.Sequence); StitcherTestHelpers.CompareQuality(new byte[] { 30, 30, 30, 40, 40, 40, 40, 40, 20, 19, 18 }, mergedRead.Qualities); //Little bit of each read1.BamAlignment.Qualities = new byte[] { 30, 30, 30, 5, 45, 5, 45, 5 }; read2.BamAlignment.Qualities = new byte[] { 40, 5, 40, 5, 40, 20, 19, 18 }; alignmentSet = new AlignmentSet(read1, read2); stitcher.TryStitch(alignmentSet); mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet); Assert.Equal("TTTATATAAAA", mergedRead.Sequence); StitcherTestHelpers.CompareQuality(new byte[] { 30, 30, 30, 40, 45, 40, 45, 40, 20, 19, 18 }, mergedRead.Qualities); //Consensus sequence should take base and assign the higher quality if both bases agree var read2_agreeingBases = TestHelper.CreateRead("chr1", "TTTTTTTT", 12342, new CigarAlignment("5M1I2M"), new byte[] { 40, 5, 40, 5, 40, 20, 19, 18 }); read1.BamAlignment.Qualities = new byte[] { 30, 30, 30, 5, 45, 5, 45, 5 }; alignmentSet = new AlignmentSet(read1, read2_agreeingBases); stitcher.TryStitch(alignmentSet); mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet); Assert.Equal("TTTTTTTTTTT", mergedRead.Sequence); StitcherTestHelpers.CompareQuality(new byte[] { 30, 30, 30, 40, 45, 40, 45, 40, 20, 19, 18 }, mergedRead.Qualities); //Bases disagree and both are below minimum quality, read1>read2 : take base/q from read1 read1.BamAlignment.Qualities = new byte[] { 30, 30, 30, 8, 8, 8, 8, 8 }; read2.BamAlignment.Qualities = new byte[] { 5, 5, 5, 5, 5, 20, 19, 18 }; alignmentSet = new AlignmentSet(read1, read2); stitcher.TryStitch(alignmentSet); mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet); Assert.Equal(read1.Sequence.Substring(3, 5), mergedRead.Sequence.Substring(overlapStart, 5)); Assert.Equal("TTTTTTTTAAA", mergedRead.Sequence); StitcherTestHelpers.CompareQuality(new byte[] { 30, 30, 30, 8, 8, 8, 8, 8, 20, 19, 18 }, mergedRead.Qualities); //Bases disagree and both are below minimum quality, read2>read1 : take base/q from read2 read1.BamAlignment.Qualities = new byte[] { 30, 30, 30, 5, 5, 5, 5, 5 }; read2.BamAlignment.Qualities = new byte[] { 8, 8, 8, 8, 8, 20, 19, 18 }; alignmentSet = new AlignmentSet(read1, read2); stitcher.TryStitch(alignmentSet); mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet); Assert.Equal(read2.Sequence.Substring(0, 5), mergedRead.Sequence.Substring(overlapStart, 5)); Assert.Equal("TTTAAAAAAAA", mergedRead.Sequence); StitcherTestHelpers.CompareQuality(new byte[] { 30, 30, 30, 8, 8, 8, 8, 8, 20, 19, 18 }, mergedRead.Qualities); //Bases disagree and both are below minimum quality, read1==read2 : take base/q from read1 read1.BamAlignment.Qualities = new byte[] { 30, 30, 30, 5, 5, 5, 5, 5 }; read2.BamAlignment.Qualities = new byte[] { 5, 5, 5, 5, 5, 20, 19, 18 }; alignmentSet = new AlignmentSet(read1, read2); stitcher.TryStitch(alignmentSet); mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet); Assert.Equal(read1.Sequence.Substring(3, 5), mergedRead.Sequence.Substring(overlapStart, 5)); Assert.Equal("TTTTTTTTAAA", mergedRead.Sequence); StitcherTestHelpers.CompareQuality(new byte[] { 30, 30, 30, 5, 5, 5, 5, 5, 20, 19, 18 }, mergedRead.Qualities); }
public void TryStitch_WithXCTag() { const string xcTagDiffFromCalculated = "4M2I4M"; const string expectedCalculatedCigar = "10M"; var read1 = TestHelper.CreateRead("chr1", "ATCGATCG", 12345, new CigarAlignment("8M"), qualityForAll: 30); var read2_overlap = TestHelper.CreateRead("chr1", "ATCGTT", 12349, new CigarAlignment("6M"), qualityForAll: 30); var stitcher = StitcherTestHelpers.GetStitcher(10); // ----------------------------------------------- // XC tag is available, and matching between R1 and R2, and expected length, // but is different from the cigar string we would have calculated // ----------------------------------------------- // XC tag should be taken read1.StitchedCigar = new CigarAlignment(xcTagDiffFromCalculated); read2_overlap.StitchedCigar = new CigarAlignment(xcTagDiffFromCalculated); var alignmentSet = new AlignmentSet(read1, read2_overlap); stitcher.TryStitch(alignmentSet); var mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet); Assert.Equal(xcTagDiffFromCalculated, mergedRead.CigarData.ToString()); // ----------------------------------------------- // XC tag is there, and matching between R1 and R2, but not expected length // ----------------------------------------------- // XC tag should be ignored if it is not expected length, and new cigar should be calculated read1.StitchedCigar = new CigarAlignment("8M"); read2_overlap.StitchedCigar = new CigarAlignment("8M"); alignmentSet = new AlignmentSet(read1, read2_overlap); stitcher.TryStitch(alignmentSet); mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet); Assert.Equal(expectedCalculatedCigar, mergedRead.CigarData.ToString()); // ----------------------------------------------- // XC tag is there on one read but not the other // ----------------------------------------------- // XC tag should be ignored, and new cigar should be calculated read1.StitchedCigar = null; read2_overlap.StitchedCigar = new CigarAlignment("9M1I"); alignmentSet = new AlignmentSet(read1, read2_overlap); stitcher.TryStitch(alignmentSet); mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet); Assert.Equal(expectedCalculatedCigar, mergedRead.CigarData.ToString()); read1.StitchedCigar = new CigarAlignment("9M1I"); read2_overlap.StitchedCigar = null; alignmentSet = new AlignmentSet(read1, read2_overlap); stitcher.TryStitch(alignmentSet); mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet); Assert.Equal(expectedCalculatedCigar, mergedRead.CigarData.ToString()); // ----------------------------------------------- // XC tag is not there // ----------------------------------------------- // New cigar should be calculated read1.StitchedCigar = null; read2_overlap.StitchedCigar = null; alignmentSet = new AlignmentSet(read1, read2_overlap); stitcher.TryStitch(alignmentSet); mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet); Assert.Equal(expectedCalculatedCigar, mergedRead.CigarData.ToString()); }
public void TryStitch_WithXCTag() { const string xcTagDiffFromCalculated = "4M2I4M"; const string expectedCalculatedCigar = "10M"; var xcRequiredStitcher = GetXCStitcher(); // ----------------------------------------------- // XC tag is available, and matching between R1 and R2, and expected length, // but is different from the cigar string we would have calculated // ----------------------------------------------- // [If require XC] // XC tag should be taken var alignmentSet = StitcherTestHelpers.GetOverlappingReadSet(); alignmentSet.PartnerRead1.StitchedCigar = new CigarAlignment(xcTagDiffFromCalculated); alignmentSet.PartnerRead2.StitchedCigar = new CigarAlignment(xcTagDiffFromCalculated); xcRequiredStitcher.TryStitch(alignmentSet); Assert.Equal(1, alignmentSet.ReadsForProcessing.Count); var mergedRead = alignmentSet.ReadsForProcessing.First(); Assert.Equal(xcTagDiffFromCalculated, mergedRead.CigarData.ToString()); // ----------------------------------------------- // XC tag is there, and matching between R1 and R2, but not expected length // ----------------------------------------------- // [If not require XC] //bounce back to processing separately? //alignmentSet = GetOverlappingReadSet(); //alignmentSet.PartnerRead1.StitchedCigarString = "8M"; //alignmentSet.PartnerRead2.StitchedCigarString = "8M"; //stitcher.TryStitch(alignmentSet); //Assert.Equal(2, alignmentSet.ReadsForProcessing.Count); // [If require XC] //??? // ----------------------------------------------- // XC tag is there on one read but not the other // ----------------------------------------------- // [If require XC] // should bounce back to separate processing alignmentSet = StitcherTestHelpers.GetOverlappingReadSet(); alignmentSet.PartnerRead1.StitchedCigar = new CigarAlignment("4M2I4M"); alignmentSet.PartnerRead2.StitchedCigar = null; StitcherTestHelpers.TryStitchAndAssertFailed(xcRequiredStitcher, alignmentSet); alignmentSet = StitcherTestHelpers.GetOverlappingReadSet(); alignmentSet.PartnerRead1.StitchedCigar = null; alignmentSet.PartnerRead2.StitchedCigar = new CigarAlignment("4M2I4M"); StitcherTestHelpers.TryStitchAndAssertFailed(xcRequiredStitcher, alignmentSet); // ----------------------------------------------- // XC tag is not there // ----------------------------------------------- // [If require XC] // should bounce back to separate processing alignmentSet = StitcherTestHelpers.GetOverlappingReadSet(); alignmentSet.PartnerRead1.StitchedCigar = null; alignmentSet.PartnerRead2.StitchedCigar = null; StitcherTestHelpers.TryStitchAndAssertFailed(xcRequiredStitcher, alignmentSet); // ----------------------------------------------- // XC tag does not match between read1 and read2 // ----------------------------------------------- // [If require XC] // should bounce back to separate processing alignmentSet = StitcherTestHelpers.GetOverlappingReadSet(); alignmentSet.PartnerRead1.StitchedCigar = new CigarAlignment("4M2I4M"); alignmentSet.PartnerRead2.StitchedCigar = new CigarAlignment("9M1I"); StitcherTestHelpers.TryStitchAndAssertFailed(xcRequiredStitcher, alignmentSet); }
private IAlignmentStitcher GetXCStitcher() { return(StitcherTestHelpers.GetStitcher(10, true)); }
public void CallSomaticVariants_MergeReadsWithInsertion_BoundaryTests() { //Migrated from old Pisces: Originally called CallSomaticVariants_MergeReadsWithInsertion_BoundaryTests // insertion at edge of read //0 1 2 3 - - - 4 5 6 7 8 9 //- C A T A T A G G //- - - - A T A G G T A A var read1 = TestHelper.CreateRead("chr1", "CATATAGG", 1, new CigarAlignment("3M3I2M"), new byte[8], 4); var read2 = TestHelper.CreateRead("chr1", "ATAGGTAA", 4, new CigarAlignment("3S5M"), new byte[8], 1); TestSuccesfullyStitchedRead(read1, read2, 0, "3M3I5M", (mergedRead) => { Assert.NotNull(mergedRead); Assert.Equal(mergedRead.Sequence, "CATATAGGTAA"); }); //0 1 2 3 - - - 4 5 6 7 8 9 //- C A T A T A G G //- - - - - T A G G T A A read1 = TestHelper.CreateRead("chr1", "CATATAGG", 1, new CigarAlignment("3M3I2M"), new byte[8], 4); read2 = TestHelper.CreateRead("chr1", "TAGGTAA", 4, new CigarAlignment("2S5M"), new byte[8], 1); TestSuccesfullyStitchedRead(read1, read2, 0, "3M3I5M", (mergedRead) => { Assert.NotNull(mergedRead); Assert.Equal(mergedRead.Sequence, "CATATAGGTAA"); }); // shouldnt be able to stitch soft clipped areas only if XC tag not provided //0 1 2 3 - - - 4 5 6 7 8 9 //- C A T A T A G G //- - - - - T A G G T A A read1 = TestHelper.CreateRead("chr1", "CATATAGG", 1, new CigarAlignment("3M5S"), new byte[8], 4); read2 = TestHelper.CreateRead("chr1", "TAGGTAA", 4, new CigarAlignment("2S5M"), new byte[8], 1); StitcherTestHelpers.TestUnstitchableReads(read1, read2, 0, (unStitchableReads) => { Assert.Equal(1, unStitchableReads.Count(x => StitcherTestHelpers.VerifyReadsEqual(read1, x))); Assert.Equal(1, unStitchableReads.Count(x => StitcherTestHelpers.VerifyReadsEqual(read2, x))); }); }
public void TryStitch_MergeReadsSmall() { //Migrated from old Pisces: Originally called CallSomaticVariants_MergeReadsSmall //test1: happy path //0 1 2 3 4 5 6 7 8 9 //- C A T A T //- - - - A T A G G var read1 = TestHelper.CreateRead("chr1", "CATAT", 1, new CigarAlignment("5M"), new byte[] { 1, 2, 3, 4, 5 }, 4); StitcherTestHelpers.SetReadDirections(read1, DirectionType.Forward); var read2 = TestHelper.CreateRead("chr1", "ATAGG", 4, new CigarAlignment("5M"), new byte[] { 1, 20, 30, 40, 50 }, 1); StitcherTestHelpers.SetReadDirections(read2, DirectionType.Reverse); var alignmentSet = new AlignmentSet(read1, read2); var stitcher = StitcherTestHelpers.GetStitcher(10); stitcher.TryStitch(alignmentSet); TestSuccesfullyStitchedRead(read1, read2, 0, "8M", (mergedRead) => { Assert.Equal(mergedRead.Sequence, "CATATAGG"); StitcherTestHelpers.CompareQuality(new byte[] { 1, 2, 3, 4, 20, 30, 40, 50 }, mergedRead.Qualities); var expectedDirections = StitcherTestHelpers.BuildDirectionMap(new List <IEnumerable <DirectionType> > { StitcherTestHelpers.BuildDirectionSegment(DirectionType.Forward, 3), StitcherTestHelpers.BuildDirectionSegment(DirectionType.Stitched, 2), StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 3) }); StitcherTestHelpers.VerifyDirectionType(expectedDirections, mergedRead.DirectionMap); }); //test2: different bases, one with low Q //0 1 2 3 4 5 6 7 8 9 //- C A T A G //- - - - A T A G G read1 = TestHelper.CreateRead("chr1", "CATAG", 1, new CigarAlignment("5M"), new byte[] { 1, 2, 3, 4, 5 }, 4); StitcherTestHelpers.SetReadDirections(read1, DirectionType.Reverse); read2 = TestHelper.CreateRead("chr1", "ATAGG", 4, new CigarAlignment("5M"), new byte[] { 1, 20, 30, 40, 50 }, 1); StitcherTestHelpers.SetReadDirections(read2, DirectionType.Forward); TestSuccesfullyStitchedRead(read1, read2, 10, "8M", (mergedRead) => { Assert.NotNull(mergedRead); Assert.Equal(mergedRead.Sequence, "CATATAGG"); StitcherTestHelpers.CompareQuality(new byte[] { 1, 2, 3, 4, 20, 30, 40, 50 }, mergedRead.Qualities); var expectedDirections = StitcherTestHelpers.BuildDirectionMap(new List <IEnumerable <DirectionType> > { StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 3), StitcherTestHelpers.BuildDirectionSegment(DirectionType.Stitched, 2), StitcherTestHelpers.BuildDirectionSegment(DirectionType.Forward, 3) }); StitcherTestHelpers.VerifyDirectionType(expectedDirections, mergedRead.DirectionMap); }); //test3: different bases, both with high Q //0 1 2 3 4 5 6 7 8 9 //- C A T A G //- - - - A T A G G read1 = TestHelper.CreateRead("chr1", "CATAG", 1, new CigarAlignment("5M"), new byte[] { 100, 200, 200, 200, 200 }, 4); read2 = TestHelper.CreateRead("chr1", "ATAGG", 4, new CigarAlignment("5M"), new byte[] { 1, 20, 30, 40, 50 }, 1); StitcherTestHelpers.SetReadDirections(read1, DirectionType.Forward); StitcherTestHelpers.SetReadDirections(read2, DirectionType.Reverse); TestSuccesfullyStitchedRead(read1, read2, 10, "8M", (mergedRead) => { Assert.NotNull(mergedRead); Assert.Equal(mergedRead.Sequence, "CATANAGG"); StitcherTestHelpers.CompareQuality(new byte[] { 100, 200, 200, 200, 0, 30, 40, 50 }, mergedRead.Qualities); var expectedDirections = StitcherTestHelpers.BuildDirectionMap(new List <IEnumerable <DirectionType> > { StitcherTestHelpers.BuildDirectionSegment(DirectionType.Forward, 3), StitcherTestHelpers.BuildDirectionSegment(DirectionType.Stitched, 2), StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 3) }); StitcherTestHelpers.VerifyDirectionType(expectedDirections, mergedRead.DirectionMap); }); }