static void Main(string[] args)
{
string strPath = Environment.GetFolderPath(Environment.SpecialFolder.DesktopDirectory);
string[] files = Directory.GetFiles(strPath + @"\Rosalind", "*.txt"); //Assumes only one txt file in this directory - the data set
string[] lines = { "" };
lines = File.ReadAllLines(files[0]);
List <Fasta> fastas = Fasta.DecodeFasta(lines);
Stopwatch itime = new Stopwatch();
string[] dnaOnly = new string[fastas.Count];
for (int i = 0; i < fastas.Count; i++)
{
dnaOnly[i] = fastas[i].DNA;
}
itime.Start();
Console.WriteLine(LongestCommonSubstring(dnaOnly.ToList()));
itime.Stop();
Console.WriteLine("Took: {0}ms", itime.ElapsedMilliseconds);
Console.ReadLine();
}
static void databaseMaker_OnInvalidHeader(object sender, FastaEvent e)
{
Fasta fasta = e.Fasta;
Console.WriteLine("\nInvalid Header!");
Console.WriteLine(fasta.Description);
}
public void PopulateATCGDnaFastaFormat()
{
FastaReader fastaReader = new FastaReader(new StringReader(">DNA\nATCG"));
Fasta fasta = fastaReader.Read();
Assert.AreEqual("ATCG", fasta.Dna);
}
public void PopulateDEFHeaderFastaFormat()
{
FastaReader fastaReader = new FastaReader(new StringReader(">DEF"));
Fasta fasta = fastaReader.Read();
Assert.AreEqual("DEF", fasta.Header);
}
public void PopulateMultiLineDnaFastaFormat()
{
FastaReader fastaReader = new FastaReader(new StringReader(">DNA\nATCGGGCTAAT\nATCGGGCTAAT\nATCGGGCTAAT\nATCGGGCTAAT"));
Fasta fasta = fastaReader.Read();
Assert.AreEqual("ATCGGGCTAATATCGGGCTAATATCGGGCTAATATCGGGCTAAT", fasta.Dna);
}
public void GcContentTests()
{
// Arrange
var fasta = new Fasta();
const int entryCount = 3;
var highestGcRatio = 0m;
const decimal expectedGcRatio = 60.919540m;
var highestFastaLabel = "";
const string expectedFastaLabel = "Rosalind_0808";
// Act
var entries = fasta.ReadEntries(@"Data\GC\GC_SampleDataSet.txt");
foreach (var entry in entries)
{
var ratio = entry.Dna.CalculateGcRatio();
if (ratio > highestGcRatio)
{
highestGcRatio = ratio;
highestFastaLabel = entry.Label;
}
}
highestGcRatio = Math.Round(highestGcRatio * 100, 6);
// Assert
Assert.That(entryCount, Is.EqualTo(entries.Count));
Assert.That(expectedGcRatio, Is.EqualTo(highestGcRatio));
Assert.That(expectedFastaLabel, Is.EqualTo(highestFastaLabel));
}
static void Main(string[] args)
{
string strPath = Environment.GetFolderPath(Environment.SpecialFolder.DesktopDirectory);
string[] files = Directory.GetFiles(strPath + @"\Rosalind", "*.txt"); //Assumes only one txt file in this directory - the data set
string[] lines = { "" };
foreach (string file in files)
{
lines = File.ReadAllLines(file);
}
List <Fasta> fastaList = Fasta.DecodeFasta(lines);
string[] strings = new string[fastaList.Count];
for (int i = 0; i < fastaList.Count; i++)
{
strings[i] = fastaList[i].DNA;
}
ProfileMatrix matrix = new ProfileMatrix(strings);
Console.WriteLine(matrix.ConsensusString);
ProfileMatrix.OutputProfileMatrix(matrix);
Console.ReadLine();
}
static void Main(string[] args)
{
string strPath = Environment.GetFolderPath(Environment.SpecialFolder.DesktopDirectory);
string[] files = Directory.GetFiles(strPath + @"\Rosalind", "*.txt"); //Assumes only one txt file in this directory - the data set
string[] lines = { "" };
foreach (string file in files)
{
lines = File.ReadAllLines(file);
}
List <Fasta> fastaList = Fasta.DecodeFasta(lines);
string[] dnaStrings = new string[fastaList.Count];
for (int i = 0; i < fastaList.Count; i++)
{
dnaStrings[i] = fastaList[i].DNA;
}
string[] introns = dnaStrings.Skip(1).ToArray();
for (int i = 0; i < introns.Length; i++)
{
introns[i] = introns[i].Replace('T', 'U');
}
Console.WriteLine(TranscribeRNAToProtein(dnaStrings[0].Replace('T', 'U'), introns));
Console.ReadLine();
}
// This private method is called when an event should be
// thrown. It first does context-switching, i.e. setting
// a public variable (OnInvalidHeader) to a local variable
// to prevent race conditions. Then it checks to see if
// there are any event handlers registered with it (the null
// check). If no one is listening to this event, it does nothing.
// If there are one or more listeners to this event, it "raises"
// the event and those are handled by their respective methods.
private void InvalidHeader(Fasta fasta)
{
var handler = OnInvalidHeader;
if (handler != null)
{
handler(this, new FastaEvent(fasta));
}
}
static void Main(string[] _)
{
Dbg.Write("Starting Fasta Profiling");
Perf.causalProfiling(10,
FuncConvert.FromAction(() => Fasta.Run(new[] { "25000000" })));
Dbg.Write("Finished Fasta Profiling");
}
public void HandleMultipleFastaFormatWithEmptyLines()
{
FastaReader fastaReader = new FastaReader(new StringReader(">DNA\nATCGGGCTAAT\nATCGGGCTAAT\n\n>Number2\nATCGGGCTAAT\nATCGGGCTAAT"));
Fasta fasta = fastaReader.Read();
Assert.AreEqual("DNA", fasta.Header);
Assert.AreEqual("ATCGGGCTAATATCGGGCTAAT", fasta.Dna);
fasta = fastaReader.Read();
Assert.AreEqual("Number2", fasta.Header);
Assert.AreEqual("ATCGGGCTAATATCGGGCTAAT", fasta.Dna);
}
static void Main(string[] args)
{
string strPath = Environment.GetFolderPath(Environment.SpecialFolder.DesktopDirectory);
string[] files = Directory.GetFiles(strPath + @"\Rosalind", "*.txt"); //Assumes only one txt file in this directory - the data set
string[] lines = { "" };
foreach (string file in files)
{
lines = File.ReadAllLines(file);
}
Regex regex = new Regex(@"N[^P][ST][^P]", RegexOptions.Multiline);
string url = @"http://www.uniprot.org/uniprot/";
List <(string id, int[] positions)> tuples = new List <(string id, int[] positions)>();
foreach (string protein in lines)
{
List <int> positions = new List <int>();
(string id, int[] positions)tuple;
tuple.id = protein;
string html = MakeGetRequest(url + protein + ".fasta");
Fasta fasta = Fasta.DecodeFasta(html.Split('\n'))[0];
for (int i = 0; i < fasta.DNA.Length - 4; i++)
{
if (regex.IsMatch(fasta.DNA.Substring(i, 4)))
{
positions.Add(i + 1);
}
}
if (positions.Count != 0)
{
tuple.positions = positions.ToArray();
tuples.Add(tuple);
}
}
for (int i = 0; i < tuples.Count; i++)
{
if (tuples[i].positions.Length != 0)
{
Console.WriteLine(tuples[i].id);
tuples[i].positions.ToList().ForEach(s => Console.Write(s + " "));
Console.WriteLine();
}
}
Console.ReadLine();
}
private List <List <Variant> > GetMutations(Fasta seq, WregexResult r)
{
int i1 = 0, i2;
while (i1 < seq.mVariants.Count && (int)seq.mVariants[i1].pos < r.Index)
{
i1++;
}
i2 = i1;
while (i2 < seq.mVariants.Count && (int)seq.mVariants[i2].pos < (r.Index + r.Length))
{
i2++;
}
return(GetMutations(seq, i1, i2 - 1));
}
// local の BLASTDB に対して Accession で検索します。
public static KeyValuePair <string, string> GetCoronaReference(string accession, ref string message)
{
var localReference = Path.Combine(
FluGASv25.Proc.Flow.CommonFlow.GetBlastReferenceDir,
CommonFlow.covBaseName + FnaFooter);
var fastaDic = Fasta.FastaFile2Dic(localReference);
var targetFastas = fastaDic.Where(s => s.Key.Split(".").First() == accession);
if (targetFastas.Any())
{
return(targetFastas.First()); // 正常取得
}
// error...
message += "not found accession, " + accession;
return(new KeyValuePair <string, string>(string.Empty, string.Empty));
}
private List <List <Variant> > GetMutations(Fasta seq, int max)
{
List <List <Variant> > result = new List <List <Variant> >();
int i1 = 0, i2 = 0;
while (i1 < seq.mVariants.Count)
{
do
{
i2++;
} while(i2 < seq.mVariants.Count && (seq.mVariants[i2].pos - seq.mVariants[i2 - 1].pos) <= (ulong)max);
result.AddRange(GetMutations(seq, i1, i2 - 1));
i1 = i2;
}
return(result);
}
private void LoadFasta(string path)
{
string line;
//char[] sep = new char[]{'|',' ','\t'};
char[] sep = new char[] { '|' };
Variant v;
UnixCfg rd = new UnixCfg(path);
line = rd.ReadUnixLine();
if (line == null || line[0] != '>')
{
throw new ApplicationException("FASTA header not found");
}
Fasta f = new Fasta(Fasta.Type.Protein, line.Split(sep)[0].Substring(1), "");
do
{
line = rd.ReadUnixLine();
if (line == null || line[0] == '>') // EOF or next element
{
if (f.mSequence.Length == 0)
{
throw new ApplicationException("FASTA sequence not found");
}
mSeqs.Add(f);
if (line != null)
{
f = new Fasta(Fasta.Type.Protein, line.Split(sep)[0].Substring(1), "");
}
}
else if (line.StartsWith("NP_")) // Variant
{
v = new Variant(line);
if (!f.mVariants.Contains(v))
{
f.mVariants.Add(v);
}
}
else // Sequence
{
f.mSequence += line;
}
} while(line != null);
rd.Close();
}
private void LoadXml(string path, SortedList <string, List <Variant> > list)
{
UniprotXml xml = new UniprotXml(path);
EhuBio.Database.Ebi.Xml.entry e;
Fasta f = null;
bool skip = false;
while ((e = xml.ReadEntry()) != null)
{
if (e.sequence == null || e.sequence.Value == null || e.sequence.Value.Length == 0)
{
continue;
}
if (list != null)
{
skip = true;
foreach (EhuBio.Database.Ebi.Xml.featureType feature in e.feature)
{
if (feature.type == EhuBio.Database.Ebi.Xml.featureTypeType.sequencevariant && feature.id != null)
{
if (list.ContainsKey(feature.id))
{
if (skip == true)
{
f = new Fasta(Fasta.Type.Protein, e.accession[0], e.sequence.Value);
skip = false;
}
f.mVariants.AddRange(list[feature.id]);
}
}
}
}
else
{
f = new Fasta(Fasta.Type.Protein, e.accession[0], e.sequence.Value);
}
if (skip)
{
continue;
}
f.Dump(true);
mSeqs.Add(f);
}
xml.Close();
}
static void Main(string[] args)
{
string strPath = Environment.GetFolderPath(Environment.SpecialFolder.DesktopDirectory);
string[] files = Directory.GetFiles(strPath + @"\Rosalind", "*.txt"); //Assumes only one txt file in this directory - the data set
string[] lines = { "" };
foreach (string file in files)
{
lines = File.ReadAllLines(file);
}
Fasta fasta = Fasta.DecodeFasta(lines)[0];
List <string> proteins = ReadFrames(fasta.DNA);
proteins.ForEach((s) => Console.WriteLine(s));
Console.ReadLine();
}
static void Main(string[] args)
{
string strPath = Environment.GetFolderPath(Environment.SpecialFolder.DesktopDirectory);
string[] files = Directory.GetFiles(strPath + @"\Rosalind", "*.txt"); //Assumes only one txt file in this directory - the data set
string[] lines = { "" };
foreach (string file in files)
{
lines = File.ReadAllLines(file);
}
Fasta fasta = Fasta.DecodeFasta(lines)[0];
int?[][] palindromes = FindDNAReversePalindrome(fasta.DNA, 4, 12);
Console.WriteLine();
Console.ReadLine();
}
/// <summary>
/// Solves the GC problem (http://rosalind.info/problems/gc/).
/// </summary>
private static void SolveGc()
{
var fasta = new Fasta();
var entries = fasta.ReadEntries(@"Data\GC\rosalind_gc.txt");
var highestGCRatio = 0m;
var highestFastaLabel = "";
foreach (var entry in entries)
{
var ratio = entry.Dna.CalculateGcRatio();
if (ratio > highestGCRatio)
{
highestGCRatio = ratio;
highestFastaLabel = entry.Label;
}
}
highestGCRatio = Math.Round(highestGCRatio * 100, 6);
var result = String.Format("{0}\n{1}%", highestFastaLabel, highestGCRatio).Replace(',', '.');
SaveResult(@"Results\rosalind_gc_results.txt", result);
}
private List<WregexResult> GetTotalVariantsResults( Fasta seq )
{
List<WregexResult> ret = new List<WregexResult>();
WregexResult[] orig, mut;
bool found;
int i, j;
List<List<Variant>> mutations;
string id;
// Original (without mutations)
orig = mRegex.Search(seq.mSequence, seq.ID+"-orig").ToArray();
ret.AddRange( orig );
// Lost
foreach( WregexResult r in orig ) {
/*if( r.Entry.Contains("NP_002968.1") )
Console.WriteLine( "KK" );*/
mutations = GetMutations( seq, r );
foreach( List<Variant> m in mutations )
if( GetVariantsResults(seq.ID, r.Match, r.Index, m).Count == 0 ) {
WregexResult r2 = r;
r2.Type = ResultType.Lost;
r2.Entry = r2.Entry.Replace("-orig","-lost") + GetID(m, r, true);
ret.Add( r2 );
}
}
// Mutations
mutations = GetMutations( seq, mRegex.MaxLength );
mut = GetVariantsResults( seq.ID, seq.mSequence, mutations ).ToArray();
for( i = 0; i < mut.Length; i++ ) {
// Filter duplicates
found = false;
foreach( WregexResult r in ret )
if( r.Index == mut[i].Index && r.Match.Equals(mut[i].Match) ) {
found = true;
break;
}
if( found )
continue;
// Assign names
id = GetID ( seq.mVariants, mut[i] );
if( id.Length == 0 )
continue;
mut[i].Entry += id;
// Gained
found = false;
for( j = 0; j < orig.Length; j++ )
if( mut[i].Index == orig[j].Index ) {
found = true;
break;
}
if( !found )
mut[i].Type = ResultType.Gained;
ret.Add( mut[i] );
}
return ret.Count == 0 ? null : ret;
}
public void ReadReturnsFastaFormat()
{
FastaReader fastaReader = new FastaReader(new StringReader(""));
Fasta fasta = fastaReader.Read();
}
public void Write(Fasta fasta)
{
Write(fasta.Sequence, fasta.Description);
}
private List<List<Variant>> GetMutations( Fasta seq, int max )
{
List<List<Variant>> result = new List<List<Variant>>();
int i1 = 0, i2 = 0;
while( i1 < seq.mVariants.Count ) {
do {
i2++;
} while( i2 < seq.mVariants.Count && (seq.mVariants[i2].pos-seq.mVariants[i2-1].pos) <= (ulong)max );
result.AddRange(GetMutations(seq,i1,i2-1));
i1 = i2;
}
return result;
}
private List <WregexResult> GetTotalVariantsResults(Fasta seq)
{
List <WregexResult> ret = new List <WregexResult>();
WregexResult[] orig, mut;
bool found;
int i, j;
List <List <Variant> > mutations;
string id;
// Original (without mutations)
orig = mRegex.Search(seq.mSequence, seq.ID + "-orig").ToArray();
ret.AddRange(orig);
// Lost
foreach (WregexResult r in orig)
{
/*if( r.Entry.Contains("NP_002968.1") )
* Console.WriteLine( "KK" );*/
mutations = GetMutations(seq, r);
foreach (List <Variant> m in mutations)
{
if (GetVariantsResults(seq.ID, r.Match, r.Index, m).Count == 0)
{
WregexResult r2 = r;
r2.Type = ResultType.Lost;
r2.Entry = r2.Entry.Replace("-orig", "-lost") + GetID(m, r, true);
ret.Add(r2);
}
}
}
// Mutations
mutations = GetMutations(seq, mRegex.MaxLength);
mut = GetVariantsResults(seq.ID, seq.mSequence, mutations).ToArray();
for (i = 0; i < mut.Length; i++)
{
// Filter duplicates
found = false;
foreach (WregexResult r in ret)
{
if (r.Index == mut[i].Index && r.Match.Equals(mut[i].Match))
{
found = true;
break;
}
}
if (found)
{
continue;
}
// Assign names
id = GetID(seq.mVariants, mut[i]);
if (id.Length == 0)
{
continue;
}
mut[i].Entry += id;
// Gained
found = false;
for (j = 0; j < orig.Length; j++)
{
if (mut[i].Index == orig[j].Index)
{
found = true;
break;
}
}
if (!found)
{
mut[i].Type = ResultType.Gained;
}
ret.Add(mut[i]);
}
return(ret.Count == 0 ? null : ret);
}
private List <List <Variant> > GetMutations(Fasta seq, int i1, int i2)
{
List <List <Variant> > result = new List <List <Variant> >();
int len = i2 - i1 + 1;
if (len <= 0)
{
return(result);
}
List <Variant> comb;
char[] array;
int combinations = 1 << len;
bool dup;
for (int i = 1; i < combinations; i++)
{
array = Convert.ToString(i, 2).ToCharArray();
comb = new List <Variant>();
for (int j = 0; j < array.Length; j++)
{
if (array[array.Length - j - 1] == '1')
{
dup = false;
foreach (Variant v in comb)
{
if (v.pos == seq.mVariants[i1 + j].pos)
{
dup = true;
break;
}
}
if (!dup)
{
comb.Add(seq.mVariants[i1 + j]);
}
}
}
dup = false;
foreach (List <Variant> list in result)
{
if (list.Count != comb.Count)
{
continue;
}
dup = true;
foreach (Variant v in comb)
{
if (!list.Contains(v))
{
dup = false;
break;
}
}
if (dup)
{
break;
}
}
if (!dup)
{
result.Add(comb);
}
}
return(result);
}
public FastaEvent(Fasta fasta)
{
Fasta = fasta;
}
private List <List <Variant> > GetMutations(Fasta seq)
{
return(GetMutations(seq, 20000));
}
private List<List<Variant>> GetMutations( Fasta seq, WregexResult r )
{
int i1 = 0, i2;
while( i1 < seq.mVariants.Count && (int)seq.mVariants[i1].pos < r.Index )
i1++;
i2 = i1;
while( i2 < seq.mVariants.Count && (int)seq.mVariants[i2].pos < (r.Index+r.Length) )
i2++;
return GetMutations( seq, i1, i2-1 );
}
private void LoadXml( string path, SortedList<string,List<Variant>> list )
{
UniprotXml xml = new UniprotXml( path );
EhuBio.Database.Ebi.Xml.entry e;
Fasta f = null;
bool skip = false;
while( (e=xml.ReadEntry()) != null ) {
if( e.sequence == null || e.sequence.Value == null || e.sequence.Value.Length == 0 )
continue;
if( list != null ) {
skip = true;
foreach( EhuBio.Database.Ebi.Xml.featureType feature in e.feature )
if( feature.type == EhuBio.Database.Ebi.Xml.featureTypeType.sequencevariant && feature.id != null )
if( list.ContainsKey(feature.id) ) {
if( skip == true ) {
f = new Fasta( Fasta.Type.Protein, e.accession[0], e.sequence.Value );
skip = false;
}
f.mVariants.AddRange( list[feature.id] );
}
} else
f = new Fasta( Fasta.Type.Protein, e.accession[0], e.sequence.Value );
if( skip )
continue;
f.Dump( true );
mSeqs.Add( f );
}
xml.Close();
}
private List<List<Variant>> GetMutations( Fasta seq, int i1, int i2 )
{
List<List<Variant>> result = new List<List<Variant>>();
int len = i2 - i1 + 1;
if( len <= 0 )
return result;
List<Variant> comb;
char[] array;
int combinations = 1 << len;
bool dup;
for( int i = 1; i < combinations; i++ ) {
array = Convert.ToString(i,2).ToCharArray();
comb = new List<Variant>();
for( int j = 0; j < array.Length; j++ )
if( array[array.Length-j-1] == '1' ) {
dup = false;
foreach( Variant v in comb )
if( v.pos == seq.mVariants[i1+j].pos ) {
dup = true;
break;
}
if( !dup )
comb.Add( seq.mVariants[i1+j] );
}
dup = false;
foreach( List<Variant> list in result ) {
if( list.Count != comb.Count )
continue;
dup = true;
foreach( Variant v in comb )
if( !list.Contains(v) ) {
dup = false;
break;
}
if( dup )
break;
}
if( !dup )
result.Add( comb );
}
return result;
}
private void LoadFasta( string path )
{
string line;
//char[] sep = new char[]{'|',' ','\t'};
char[] sep = new char[]{'|'};
Variant v;
UnixCfg rd = new UnixCfg( path );
line = rd.ReadUnixLine();
if( line == null || line[0] != '>' )
throw new ApplicationException( "FASTA header not found" );
Fasta f = new Fasta(Fasta.Type.Protein, line.Split(sep)[0].Substring(1), "");
do {
line = rd.ReadUnixLine();
if( line == null || line[0] == '>' ) { // EOF or next element
if( f.mSequence.Length == 0 )
throw new ApplicationException( "FASTA sequence not found" );
mSeqs.Add(f);
if( line != null )
f = new Fasta(Fasta.Type.Protein, line.Split(sep)[0].Substring(1), "");
} else if( line.StartsWith("NP_") ) { // Variant
v = new Variant(line);
if( !f.mVariants.Contains(v) )
f.mVariants.Add(v);
}
else // Sequence
f.mSequence += line;
} while( line != null );
rd.Close();
}
private List<List<Variant>> GetMutations( Fasta seq )
{
return GetMutations( seq, 20000 );
}
public void ReadTest()
{
var result = Fasta.Read(@"F:\JICWork\miRNA_no_akr.fasta");
}
public FastaEvent(Fasta fasta)
{
Fasta = fasta;
}
public static void runCosmic( string file )
{
StreamReader rd = new StreamReader(new GZipStream(new FileStream(file,FileMode.Open), CompressionMode.Decompress));
string line;
char[] sep1 = new char[]{','};
char[] sep2 = new char[]{':'};
string[] fields, fields2;
String mut, prot;
Variant v;
Fasta f;
List<string> ids = new List<string>();
SortedList<string,Fasta> fasta = new SortedList<string, Fasta>();
bool first = true;
//int count = 1;
while( (line=rd.ReadLine()) != null ) {
if( first ) {
first = false;
continue;
}
fields = line.Split(sep1);
if( fields[4].Length == 0 )
continue;
if( fasta.ContainsKey(fields[4]) )
f = fasta[fields[4]];
else {
WSDBFetchServerService server = new WSDBFetchServerService();
server.
f = new Fasta(Fasta.Type.Protein,fields[4],seq);
}
v = new Variant();
if( ids.Contains(fields[4]) )
continue;
ids.Add(fields[0]);
sreq.id = fields[0];
sres = ssrv.run_eFetch( sreq );
if( sres == null || sres.ExchangeSet.Rs == null || sres.ExchangeSet.Rs.Length == 0 )
continue;
Console.WriteLine( fields[0] + "..." );
foreach( string str in sres.ExchangeSet.Rs[0].hgvs ) {
if( !str.StartsWith("NP_") )
continue;
Console.Write( str + " " );
v = new Variant();
v.id = str;
fields2 = str.Split(sep2);
mut = fields2[1]; prot = fields2[0];
try {
v.orig = AminoAcid.Get(mut.Substring(2,3)).Letter;
v.mut = AminoAcid.Get(mut.Substring(mut.Length-3,3)).Letter;
v.pos = ulong.Parse(mut.Substring(5,mut.Length-8))-1;
} catch {
Console.WriteLine( "(filtered)" );
continue;
}
if( fasta.ContainsKey(prot) ) {
Console.WriteLine( "(cached)" );
f = fasta[prot];
} else {
preq.db = "protein";
preq.id = prot;
pres = psrv.run_eFetch( preq );
f = new Fasta(Fasta.Type.Protein,prot+"|"+pres.GBSet[0].GBSeq_definition,pres.GBSet[0].GBSeq_sequence);
fasta.Add( prot, f );
Console.WriteLine( "(downloaded)" );
}
f.mVariants.Add( v );
}
/*if( --count == 0 )
break;*/
}
foreach( Fasta fas in fasta.Values )
fas.Dump( true );
}
// This private method is called when an event should be
// thrown. It first does context-switching, i.e. setting
// a public variable (OnInvalidHeader) to a local variable
// to prevent race conditions. Then it checks to see if
// there are any event handlers registered with it (the null
// check). If no one is listening to this event, it does nothing.
// If there are one or more listeners to this event, it "raises"
// the event and those are handled by their respective methods.
private void InvalidHeader(Fasta fasta)
{
var handler = OnInvalidHeader;
if (handler != null)
{
handler(this, new FastaEvent(fasta));
}
}
public static void runEnsembl(string file)
{
StreamReader rd = new StreamReader(new GZipStream(new FileStream(file, FileMode.Open), CompressionMode.Decompress));
string line;
char[] sep1 = new char[] { ',' };
char[] sep2 = new char[] { ':' };
string[] fields, fields2;
String mut, prot;
Variant v;
Fasta f;
List <string> ids = new List <string>();
SortedList <string, Fasta> fasta = new SortedList <string, Fasta>();
eFetchSnpService ssrv = new eFetchSnpService();
EhuBio.Database.Ncbi.eFetch.Snp.MessageEFetchRequest sreq = new EhuBio.Database.Ncbi.eFetch.Snp.MessageEFetchRequest();
EhuBio.Database.Ncbi.eFetch.Snp.MessageEFetchResult sres;
eFetchSequenceService psrv = new eFetchSequenceService();
EhuBio.Database.Ncbi.eFetch.Sequences.MessageEFetchRequest preq = new EhuBio.Database.Ncbi.eFetch.Sequences.MessageEFetchRequest();
EhuBio.Database.Ncbi.eFetch.Sequences.MessageEFetchResult pres;
//int count = 1;
while ((line = rd.ReadLine()) != null)
{
fields = line.Split(sep1);
if (!fields[2].Contains("/") || fields[3].Length == 0 || fields[3] != fields[4])
{
continue;
}
v = new Variant();
if (ids.Contains(fields[0]))
{
continue;
}
ids.Add(fields[0]);
sreq.id = fields[0];
sres = ssrv.run_eFetch(sreq);
if (sres == null || sres.ExchangeSet.Rs == null || sres.ExchangeSet.Rs.Length == 0)
{
continue;
}
Console.WriteLine(fields[0] + "...");
foreach (string str in sres.ExchangeSet.Rs[0].hgvs)
{
if (!str.StartsWith("NP_"))
{
continue;
}
Console.Write(str + " ");
v = new Variant();
v.id = str;
fields2 = str.Split(sep2);
mut = fields2[1]; prot = fields2[0];
try {
v.orig = AminoAcid.Get(mut.Substring(2, 3)).Letter;
v.mut = AminoAcid.Get(mut.Substring(mut.Length - 3, 3)).Letter;
v.pos = ulong.Parse(mut.Substring(5, mut.Length - 8)) - 1;
} catch {
Console.WriteLine("(filtered)");
continue;
}
if (fasta.ContainsKey(prot))
{
Console.WriteLine("(cached)");
f = fasta[prot];
}
else
{
preq.db = "protein";
preq.id = prot;
pres = psrv.run_eFetch(preq);
f = new Fasta(Fasta.Type.Protein, prot + "|" + pres.GBSet[0].GBSeq_definition, pres.GBSet[0].GBSeq_sequence);
fasta.Add(prot, f);
Console.WriteLine("(downloaded)");
}
f.mVariants.Add(v);
}
/*if( --count == 0 )
* break;*/
}
foreach (Fasta fas in fasta.Values)
{
fas.Dump(true);
}
}
