public void BasicIntervalTesting()
{
var bamFilePath = Path.Combine(UnitTestPaths.TestDataDirectory, "var123var35.bam");
var vcfFilePath = Path.Combine(UnitTestPaths.TestDataDirectory, "var123var35.vcf");
var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup();
functionalTestRunner.GenomeDirectory = Path.Combine(UnitTestPaths.TestGenomesDirectory, "chr17chr19");
var expectedAlleles = new List <BaseCalledAllele>
{
new CalledVariant(AlleleCategory.Snv)
{
Coordinate = 3118942,
Reference = "A",
Alternate = "T",
Chromosome = "chr19"
},
new CalledVariant(AlleleCategory.Snv)
{
Coordinate = 7572985,
Reference = "T",
Alternate = "C",
Chromosome = "chr17"
}
};
// thread by chr
functionalTestRunner.Execute(bamFilePath, vcfFilePath, null, expectedAlleles, threadByChr: true);
}
public void SomaticVariantCaller_SimpleSnv()
{
var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup();
functionalTestRunner.GenomeDirectory = Path.Combine(UnitTestPaths.TestGenomesDirectory, "chr17chr19");
var expectedAlleles = new List <BaseCalledAllele>
{
new CalledVariant(AlleleCategory.Snv)
{
Coordinate = 3118942,
Reference = "A",
Alternate = "T",
Chromosome = "chr19"
}
};
var vcfFilePath = Path.ChangeExtension(_bam_SIM_DID_35_S1, "vcf");
// without reference calls
File.Delete(vcfFilePath);
functionalTestRunner.Execute(_bam_SIM_DID_35_S1, vcfFilePath, null, expectedAlleles);
// with reference calls
File.Delete(vcfFilePath);
functionalTestRunner.Execute(_bam_SIM_DID_35_S1, vcfFilePath, null, expectedAlleles, null, true, true, 102);
// with reference calls and intervals
File.Delete(vcfFilePath);
functionalTestRunner.Execute(_bam_SIM_DID_35_S1, vcfFilePath, _interval_SIM_DID_35_S1, expectedAlleles, null, true, true, 11);
}
public void BasicSNVIntervalTesting()
{
var bamFilePath = Path.Combine(UnitTestPaths.TestDataDirectory, "var123var35.bam");
var vcfFilePath = Path.Combine(UnitTestPaths.TestDataDirectory, "var123var35.vcf");
var intervalFilePath = Path.Combine(UnitTestPaths.TestDataDirectory, "chr17only.picard");
var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup();
functionalTestRunner.GenomeDirectory = Path.Combine(UnitTestPaths.TestGenomesDirectory, "chr17chr19");
var expectedAlleles = new List <BaseCalledAllele>
{
new CalledVariant(AlleleCategory.Snv)
{
Coordinate = 3118942,
Reference = "A",
Alternate = "T",
Chromosome = "chr19"
},
new CalledVariant(AlleleCategory.Snv)
{
Coordinate = 7572985,
Reference = "T",
Alternate = "C",
Chromosome = "chr17"
}
};
// Spot an expected allele inside an interval.
functionalTestRunner.Execute(bamFilePath, vcfFilePath, intervalFilePath, expectedAlleles.Where(a => a.Chromosome == "chr17").ToList());
// Ignore indels spotted outside or overlapping the interval.
functionalTestRunner.Execute(bamFilePath, vcfFilePath, intervalFilePath, expectedAlleles.Where(a => a.Chromosome == "chr17").ToList());
}
public void BasicMnvTesting()
{
var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup();
functionalTestRunner.GenomeDirectory = Path.Combine(UnitTestPaths.TestGenomesDirectory, "chr17chr19");
// Mock ChrReference for the MockGenome.
List <ChrReference> mockChrRef = new List <ChrReference>()
{
new ChrReference()
{
Name = "chr1",
Sequence = "TTGTCAGTGCGCTTTTCCCAACACCACCTGCTCCGACCACCACCAGTTTGTACTCAGTCATTTCACACCAGCAAGAACCTGTTGGAAACCAGTAATCAGGGTTAATTGGCGGCG"
}
};
var expectedAlleles = new List <BaseCalledAllele>
{
new CalledVariant(AlleleCategory.Mnv)
{
Coordinate = 27,
Reference = "CCTGCTCCG",
Alternate = "TTTGCTCCA",
Chromosome = "chr1"
},
new CalledVariant(AlleleCategory.Mnv)
{
Coordinate = 27,
Reference = "CC",
Alternate = "TT",
Chromosome = "chr1"
},
new CalledVariant(AlleleCategory.Snv)
{
Coordinate = 35,
Reference = "G",
Alternate = "A",
Chromosome = "chr1"
}
};
// Testing small_S1.bam with a MockGenome.
functionalTestRunner.Execute(_bamSmallS1, Path.ChangeExtension(_bamSmallS1, "vcf"), null, expectedAlleles, mockChrRef, doCheckReferences: true, doLog: true);
}
public void InsertionAtEdgeOfDistribution()
{
// This test was brought forward to test Deletion at the edge from the previous tests. The test was listed as failing when stitching was included.
// Notes from Old SVC: Make sure we can accurately insertions at the edge of the coverage distribution, and not accidentally mark them as SB
// This test case was in response to a bug, where originally we called SB here when we should not.
// chr7 116376907 . ATTT A 100.00 SB DP=750;
var bamFilePath = Path.Combine(UnitTestPaths.TestDataDirectory, "edgeIns_S2.bam");
var functionalTestRunner = new SomaticVariantCallerFunctionalTestSetup();
functionalTestRunner.GenomeDirectory = Path.Combine(UnitTestPaths.TestGenomesDirectory, "chr17chr19");
var appOptions = new ApplicationOptions
{
BAMPaths = new[] { bamFilePath },
IntervalPaths = null,
GenomePaths = new[] { Path.Combine(UnitTestPaths.TestGenomesDirectory, "chr17chr19") },
OutputgVCFFiles = true,
OutputBiasFiles = true,
DebugMode = true,
CallMNVs = true,
UseMNVReallocation = false,
MaxSizeMNV = 100,
FilterOutVariantsPresentOnlyOneStrand = false,
AppliedNoiseLevel = -1,
MinimumBaseCallQuality = 20,
MaximumVariantQScore = 100,
FilteredVariantQScore = 30,
MinimumVariantQScore = 20,
MaxGapBetweenMNV = 10,
MinimumCoverage = 10,
MinimumMapQuality = 1,
MinimumFrequency = 0.01f,
StrandBiasAcceptanceCriteria = 0.5f,
StrandBiasScoreMaximumToWriteToVCF = -100,
StrandBiasScoreMinimumToWriteToVCF = 0,
OnlyUseProperPairs = false,
NoiseModelHalfWindow = 1,
DoBamQC = BamQCOptions.VarCallOnly,
NoiseModel = NoiseModel.Flat,
GTModel = GenotypeModel.Symmetrical,
StrandBiasModel = StrandBiasModel.Extended,
RequireXCTagToStitch = true,
StitchReads = false
};
// Time to build the fake sequences for testing.
var mockChrRef = new List <ChrReference>()
{
new ChrReference()
{
// position 63
Name = "chr7",
Sequence = "NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN" +
"GTTGGTCTTCTATTTTATGCGAATTCTTCTAAGATTCCCAGGTTATTTATCATAAGAATTACATTTACATGGCAAATTTAGTTCTGTTCCTAGAAATATCTCCATGACAACCAAAAGGAACTCCTAATTTCTGGCACACATTACTTCAGGGGT"
}
};
var expectedAlleles = new List <BaseCalledAllele>
{
new CalledVariant(AlleleCategory.Insertion)
{
Coordinate = 110,
Reference = "T",
Alternate = "TGGG",
Chromosome = "chr7"
}
};
functionalTestRunner.Execute(bamFilePath, Path.ChangeExtension(bamFilePath, "genome.vcf"), null, expectedAlleles, mockChrRef, applicationOptions: appOptions);
}
