/// <summary> /// Gets the search results for the pertinent request identifier. /// Implementation should have dedicated parsers to format the received results into MBF /// </summary> /// <remarks>An exception is thrown if the request does not succeed.</remarks> /// <param name="requestIdentifier">Identifier for the request of interest.</param> /// <param name="parameters">Blast input parameters</param> /// <returns>The search results</returns> public string GetResult( string requestIdentifier, BlastParameters parameters) { string resultUri = _blastClient.GetJobResult(new Guid(requestIdentifier)); WebAccessor accessor = new WebAccessor(); WebAccessorResponse webAccessorResponse = null; if (Configuration.UseBrowserProxy) { accessor.GetBrowserProxy(); } webAccessorResponse = accessor.SubmitHttpRequest( new Uri(resultUri), false, // POST request new Dictionary <string, string>()); if (!webAccessorResponse.IsSuccessful) { // failure accessor.Close(); return(null); } accessor.Close(); return(webAccessorResponse.ResponseString); }
static void Main(string[] args) { int newSeriesCount = 0; int updatedSeriesCount = 0; var jsonStorageProvider = new JsonFileStorageProvider(); using (var sqlStorageProvider = new SqlStorageProvider()) { UserActivity userActivity; Index index; if (Config.Storage.ReadFromStorage) { userActivity = jsonStorageProvider.ReadUserActivity(); index = jsonStorageProvider.ReadIndex(); // index = new Index(); } else { userActivity = new UserActivity(); index = new Index(); } // high-level tasks using (var webAccessor = new WebAccessor()) { var taskRunner = new TaskRunner(webAccessor); taskRunner.LogIn(); // newSeriesCount = taskRunner.AddSeriesToIndex(index); // updatedSeriesCount = taskRunner.UpdatesSeriesToIndex(index); // taskRunner.AddGenresToIndex(index); taskRunner.UpdateUserActivity(userActivity); taskRunner.AddUserActivityToIndex(userActivity, index); } if (Config.Storage.WriteToStorage) { jsonStorageProvider.WriteIndex(index); jsonStorageProvider.WriteUserActivity(userActivity); sqlStorageProvider.WriteIndex(index); } } Console.WriteLine("Added {0} new series, updated {1}", newSeriesCount, updatedSeriesCount); Console.WriteLine("Press [Spacebar] to exit."); while (Console.ReadKey().Key != ConsoleKey.Spacebar) { } ; }
/// <summary> /// Gets the search results for the pertinent request identifier. /// Implementation should have dedicated parsers to format the received results into MBF /// </summary> /// <remarks>An exception is thrown if the request does not succeed.</remarks> /// <param name="requestIdentifier">Identifier for the request of interest.</param> /// <param name="parameters">Blast input parameters</param> /// <returns>The search results</returns> public string GetResult( string requestIdentifier, BlastParameters parameters) { string resultUri = _blastClient.GetJobResult(new Guid(requestIdentifier)); Stream responseStream = null; string statusDescription = string.Empty; WebAccessor accessor = new WebAccessor(); if (Configuration.UseBrowserProxy) { accessor.GetBrowserProxy(); } if (!accessor.SubmitHttpRequest( resultUri, false, // POST request new Dictionary <string, string>(), out statusDescription, out responseStream)) { // failure accessor.Close(); return(null); } string response = string.Empty; using (StreamReader r = new StreamReader(responseStream)) { response = r.ReadToEnd(); r.Close(); } accessor.Close(); return(response); }
/// <summary> /// Gets the search results for the pertinent request identifier. /// Implementation should have dedicated parsers to format the received results into Bio /// </summary> /// <remarks>An exception is thrown if the request does not succeed.</remarks> /// <param name="requestIdentifier">Identifier for the request of interest.</param> /// <param name="parameters">Blast input parameters</param> /// <returns>The search results</returns> public string GetResult( string requestIdentifier, BlastParameters parameters) { if (parameters == null) { throw new ArgumentNullException("parameters"); } string status = string.Empty; string information = string.Empty; WebAccessor accessor = new WebAccessor(); WebAccessorResponse webAccessorResponse = null; parameters.Add(PARAMETERCOMMAND, COMMANDGET); parameters.Add(PARAMETERJOBID, requestIdentifier); parameters.Add(PARAMETERFORMAT, FORMATXML); if (Configuration.UseBrowserProxy) { accessor.GetBrowserProxy(); } webAccessorResponse = accessor.SubmitHttpRequest( ServiceUri, true, // POST request parameters.Settings); if (!webAccessorResponse.IsSuccessful) { // failure accessor.Close(); return(null); } accessor.Close(); information = ExtractInfoSection(webAccessorResponse.ResponseString); if (!String.IsNullOrEmpty(information)) { int statusStart = information.IndexOf("Status=", StringComparison.OrdinalIgnoreCase); if (statusStart >= 0) { statusStart += "Status=".Length; int statusEnd = information.IndexOf('\n', statusStart); if (statusEnd >= 0) { status = information.Substring(statusStart, statusEnd - statusStart); } } } if (!string.IsNullOrEmpty(status)) { if (status == STATUSWAITING) { return(null); } else { string message = String.Format(CultureInfo.InvariantCulture, Resources.INVALIDNCBISTATUS, status); throw new Exception(message); } } return(webAccessorResponse.ResponseString); }
/// <summary> /// Return the status of a submitted job. /// </summary> /// <param name="requestIdentifier">Identifier for the request of interest.</param> /// <returns>The status of the request.</returns> public ServiceRequestInformation GetRequestStatus(string requestIdentifier) { string information = string.Empty; string errorInformation = string.Empty; WebAccessor accessor = new WebAccessor(); WebAccessorResponse webAccessorResponse = null; ServiceRequestInformation status = new ServiceRequestInformation(); Dictionary <string, string> settings = new Dictionary <string, string>(); settings.Add(PARAMETERCMD, "GET"); settings.Add(PARAMETERRID, System.Web.HttpUtility.UrlEncode(requestIdentifier)); if (Configuration.UseBrowserProxy) { accessor.GetBrowserProxy(); } webAccessorResponse = accessor.SubmitHttpRequest( ServiceUri, true, settings); if (!webAccessorResponse.IsSuccessful) { // failure accessor.Close(); status.Status = ServiceRequestStatus.Error; status.StatusInformation = webAccessorResponse.StatusDescription; return(status); } webAccessorResponse.StatusDescription = string.Empty; information = ExtractInfoSection(webAccessorResponse.ResponseString); if (String.IsNullOrEmpty(information)) { status.Status = ServiceRequestStatus.Error; // see if we got an error message errorInformation = ExtractBlastErrorSection(webAccessorResponse.ResponseString); if (string.IsNullOrEmpty(errorInformation)) { status.StatusInformation = "An unknown server error has occurred."; } else { status.StatusInformation = errorInformation; } return(status); } else { int statusStart = information.IndexOf("Status=", StringComparison.OrdinalIgnoreCase); if (statusStart >= 0) { statusStart += "Status=".Length; int statusEnd = information.IndexOf('\n', statusStart); if (statusEnd >= 0) { webAccessorResponse.StatusDescription = information.Substring(statusStart, statusEnd - statusStart); } } } if (webAccessorResponse.StatusDescription == STATUSWAITING) { status.Status = ServiceRequestStatus.Waiting; return(status); } else if (webAccessorResponse.StatusDescription == STATUSREADY) { status.Status = ServiceRequestStatus.Ready; return(status); } status.Status = ServiceRequestStatus.Error; status.StatusInformation = webAccessorResponse.StatusDescription; return(status); }
/// <summary> /// Submit the search request with the user supplied configuration parameters and sequence /// Implementation should make use of the Bio.IO formatters to convert the sequence into /// the web interface compliant sequence format /// </summary> /// <remarks>An exception is thrown if the request does not succeed.</remarks> /// <param name="sequences">List of sequence to search with</param> /// <param name="parameters">Blast input parameters</param> /// <returns>Request Identifier</returns> public string SubmitRequest(IList <ISequence> sequences, BlastParameters parameters) { if (null == parameters) { throw new ArgumentNullException("parameters"); } if (null != sequences) { StringBuilder sb = new StringBuilder(); foreach (ISequence seq in sequences) { sb.Append(FastAFormatter.FormatString(seq)); sb.Append("\n"); } parameters.Add("Query", sb.ToString()); } if (!string.IsNullOrEmpty(Configuration.EmailAddress)) { if (!parameters.Settings.ContainsKey(PARAMETEREMAIL)) { parameters.Add(PARAMETEREMAIL, Configuration.EmailAddress); } } string requestIdentifier = string.Empty; // Validate the Parameter ParameterValidationResult valid = ValidateParameters(parameters); if (!valid.IsValid) { throw new Exception(valid.ValidationErrors); } parameters.Add(PARAMETERCOMMAND, COMMANDPUT); WebAccessor accessor = new WebAccessor(); WebAccessorResponse webAccessorResponse; if (Configuration.UseBrowserProxy) { accessor.GetBrowserProxy(); } webAccessorResponse = accessor.SubmitHttpRequest( ServiceUri, true, // do POST parameters.Settings); // request parameters if (!webAccessorResponse.IsSuccessful) { // failed accessor.Close(); throw new Exception(String.Format(CultureInfo.InvariantCulture, Resources.HTTPSUBMITFAILED, webAccessorResponse.StatusDescription)); } string info = ExtractInfoSection(webAccessorResponse.ResponseString); if (!String.IsNullOrEmpty(info)) { int ridStart = info.IndexOf("RID = ", StringComparison.OrdinalIgnoreCase); if (ridStart >= 0) { ridStart += "RID = ".Length; int ridEnd = info.IndexOf('\n', ridStart); if (ridEnd >= 0) { requestIdentifier = info.Substring(ridStart, ridEnd - ridStart); } } } accessor.Close(); if (string.IsNullOrEmpty(requestIdentifier)) { string message = String.Format(CultureInfo.InvariantCulture, Resources.RIDEXTRACTFAILED, ExtractError(webAccessorResponse.ResponseString)); throw new Exception(message); } // Only if the event is registered, invoke the thread if (null != RequestCompleted) { BlastThreadParameter threadParameter = new BlastThreadParameter( requestIdentifier, null, // Sequence parameter is not used any where, hence passing null. parameters); // Start the BackGroundThread to check the status of job workerThread = new BackgroundWorker(); workerThread.WorkerSupportsCancellation = true; workerThread.DoWork += new DoWorkEventHandler(ProcessRequestThread); workerThread.RunWorkerCompleted += new RunWorkerCompletedEventHandler(CompletedRequestThread); workerThread.RunWorkerAsync(threadParameter); } return(requestIdentifier); }
/// <summary> /// Validate general SubmitHttpRequest() method by passing /// differnt XML node name /// <param name="nodeName">xml node name.</param> /// </summary> void ValidateSubmitHttpRequestMethod(string nodeName) { // Gets the search query parameter and their values. string querySequence = utilityObj.xmlUtil.GetTextValue( nodeName, Constants.QuerySequency); string queryDatabaseValue = utilityObj.xmlUtil.GetTextValue( nodeName, Constants.DatabaseValue); string queryProgramValue = utilityObj.xmlUtil.GetTextValue( nodeName, Constants.ProgramValue); string queryDatabaseParameter = utilityObj.xmlUtil.GetTextValue( nodeName, Constants.DatabaseParameter); string queryProgramParameter = utilityObj.xmlUtil.GetTextValue( nodeName, Constants.ProgramParameter); string queryParameter = utilityObj.xmlUtil.GetTextValue( nodeName, Constants.QuerySequencyparameter); string webUri = utilityObj.xmlUtil.GetTextValue( Constants.BlastRequestParametersNode, Constants.BlastWebServiceUri); WebAccessorResponse requestResult = null; // Set Service confiruration parameters true. IBlastServiceHandler blastService = null; try { blastService = new NCBIBlastHandler(); ConfigParameters configParameters = new ConfigParameters(); configParameters.UseBrowserProxy = true; blastService.Configuration = configParameters; // Create search parameters object. BlastParameters queryParams = new BlastParameters(); // Add mandatory parameter values to search query parameters. queryParams.Add(queryParameter, querySequence); queryParams.Add(queryDatabaseParameter, queryDatabaseValue); queryParams.Add(queryProgramParameter, queryProgramValue); //Submit Http request WebAccessor webAccessor = new WebAccessor(); webAccessor.GetBrowserProxy(); requestResult = webAccessor.SubmitHttpRequest(new Uri(webUri), true, queryParams.Settings); // Validate the Submitted request. Assert.IsTrue(requestResult.IsSuccessful); ApplicationLog.WriteLine(string.Format((IFormatProvider)null, "Http Request was submitted successfully")); ApplicationLog.WriteLine(string.Format((IFormatProvider)null, "Blast P1: DataBase Value {0} is as expected.", queryDatabaseValue)); ApplicationLog.WriteLine(string.Format((IFormatProvider)null, "Blast P1: Program Value {0} is as expected.", queryProgramValue)); ApplicationLog.WriteLine(string.Format((IFormatProvider)null, "Blast P1: Query sequence {0} is as expected.", querySequence)); webAccessor.Close(); } finally { if (blastService != null) ((IDisposable)blastService).Dispose(); } }
public void BeginAsyncRequestTest() { BlastParameters searchParams = new BlastParameters(); // fill in the BLAST settings: searchParams.Add("Command", "Put"); searchParams.Add("Program", "blastn"); searchParams.Add("Expect", "1e-10"); searchParams.Add("CompositionBasedStatistics", "0"); string badDbName = "ThisDatabaseDoesNotExist"; searchParams.Add("Database", badDbName); // test parameters string sequence = @"GACGCCGCCGCCACCACCGCCACCGCCGCAGCAGAAGCAGCGCACCGCAGGAGGGAAG" + "ATGCCGGCGGGGCACGGGCTGCGGGCGCGGACGGCGACCTCTTCGCGCGGCCGTTCCGCAAGAAGGGTTA" + "CATCCCGCTCACCACCTACCTGAGGACGTACAAGATCGGCGATTACGTNGACGTCAAGGTGAACGGTG"; searchParams.Add("Query", sequence); AutoResetEvent requestSubmitWait = new AutoResetEvent(false); AsyncWebMethodRequest input = new AsyncWebMethodRequest( new Uri("http://www.ncbi.nlm.nih.gov/blast/Blast.cgi"), CredentialCache.DefaultCredentials, searchParams.Settings, BuildQueryString(searchParams.Settings), SubmitRequestCompleted, requestSubmitWait); WebAccessor target = new WebAccessor(); target.BeginAsyncRequest(input); WaitHandle.WaitAny(new WaitHandle[] { requestSubmitWait }); Assert.IsFalse(string.IsNullOrEmpty(requestIdentifier)); // query the status Dictionary <string, string> settings = new Dictionary <string, string>(); settings.Add("CMD", "GET"); settings.Add("RID", HttpUtility.UrlEncode(requestIdentifier)); AutoResetEvent requestStatusWait = new AutoResetEvent(false); input = new AsyncWebMethodRequest( new Uri("http://www.ncbi.nlm.nih.gov/blast/Blast.cgi"), CredentialCache.DefaultCredentials, settings, BuildQueryString(settings), RequestStatusCompleted, requestStatusWait); target.BeginAsyncRequest(input); WaitHandle.WaitAny(new WaitHandle[] { requestStatusWait }); bool ok = false; if (status.Status != ServiceRequestStatus.Waiting && status.Status != ServiceRequestStatus.Ready) { if (status.StatusInformation.Contains(badDbName) && status.StatusInformation.Contains("No alias or index file found for nucleotide database")) { ok = true; } } if (!ok) { Assert.Fail("Failed to find server error message for bad request. Info: " + status.StatusInformation); } }
/// <summary> /// Gets the search results for the pertinent request identifier. /// Implementation should have dedicated parsers to format the received results into MBF /// </summary> /// <remarks>An exception is thrown if the request does not succeed.</remarks> /// <param name="requestIdentifier">Identifier for the request of interest.</param> /// <param name="parameters">Blast input parameters</param> /// <returns>The search results</returns> public string GetResult( string requestIdentifier, BlastParameters parameters) { Stream responseStream = null; string status = string.Empty; string response = string.Empty; string information = string.Empty; string statusDescription = string.Empty; WebAccessor accessor = new WebAccessor(); parameters.Add(PARAMETERCOMMAND, COMMANDGET); parameters.Add(PARAMETERJOBID, requestIdentifier); parameters.Add(PARAMETERFORMAT, FORMATXML); if (Configuration.UseBrowserProxy) { accessor.GetBrowserProxy(); } if (!accessor.SubmitHttpRequest( ServiceUri, true, // POST request parameters.Settings, out statusDescription, out responseStream)) { // failure accessor.Close(); return(null); } using (StreamReader r = new StreamReader(responseStream)) { response = r.ReadToEnd(); r.Close(); } accessor.Close(); information = ExtractInfoSection(response); if (!String.IsNullOrEmpty(information)) { int statusStart = information.IndexOf("Status="); if (statusStart >= 0) { statusStart += "Status=".Length; int statusEnd = information.IndexOf('\n', statusStart); if (statusEnd >= 0) { status = information.Substring(statusStart, statusEnd - statusStart); } } } if (status != string.Empty) { if (status == STATUSWAITING) { return(null); } else { string message = String.Format( Resource.INVALIDNCBISTATUS, status); throw new Exception(message); } } return(response); }
/// <summary> /// Submit the search request with the user supplied configuration parameters /// and sequence. Implementation should make use of the Bio.IO formatters /// to convert the sequence into the web interface compliant sequence format. /// This method performs parameter validation and throw Exception on invalid input. /// </summary> /// <remarks>An exception is thrown if the request does not succeed.</remarks> /// <param name="sequence">The sequence to search with</param> /// <param name="parameters">Blast input parameters</param> /// <returns>Request Identifier</returns> public string SubmitRequest(ISequence sequence, BlastParameters parameters) { if (null != sequence) { parameters.Add("Query", sequence.ToString()); } if (null == parameters) { throw new ArgumentNullException("parameters"); } string requestIdentifier = string.Empty; // Validate the Parameter ParameterValidationResult valid = ValidateParameters(parameters); if (!valid.IsValid) { throw new Exception(valid.ValidationErrors); } parameters.Add(PARAMETERCOMMAND, COMMANDPUT); Stream responseStream = null; string statusDescription = string.Empty; WebAccessor accessor = new WebAccessor(); if (Configuration.UseBrowserProxy) { accessor.GetBrowserProxy(); } if (!accessor.SubmitHttpRequest( ServiceUri, true, // do POST parameters.Settings, // request parameters out statusDescription, out responseStream)) { // failed accessor.Close(); throw new Exception(String.Format( Resource.HTTPSUBMITFAILED, statusDescription)); } string response = string.Empty; using (StreamReader r = new StreamReader(responseStream)) { response = r.ReadToEnd(); string info = ExtractInfoSection(response); if (!String.IsNullOrEmpty(info)) { int ridStart = info.IndexOf("RID = "); if (ridStart >= 0) { ridStart += "RID = ".Length; int ridEnd = info.IndexOf('\n', ridStart); if (ridEnd >= 0) { requestIdentifier = info.Substring(ridStart, ridEnd - ridStart); } } } r.Close(); } accessor.Close(); if (string.IsNullOrEmpty(requestIdentifier)) { string message = String.Format( Resource.RIDEXTRACTFAILED, ExtractError(response)); throw new Exception(message); } // Only if the event is registered, invoke the thread if (null != RequestCompleted) { ThreadParameter threadParameter = new ThreadParameter( requestIdentifier, sequence, parameters); // Start the BackGroundThread to check the status of job _workerThread = new BackgroundWorker(); _workerThread.WorkerSupportsCancellation = true; _workerThread.DoWork += new DoWorkEventHandler(ProcessRequestThread); _workerThread.RunWorkerCompleted += new RunWorkerCompletedEventHandler(CompletedRequestThread); _workerThread.RunWorkerAsync(threadParameter); } return(requestIdentifier); }
public TaskRunner(WebAccessor webAccessor) { this.WebAccessor = webAccessor; }