//Constructor for searches unbounded by part types
public Part(String partType)
{
InitializeComponent();
Orientation = 0;
CanScale = false;
CanRotate = false;
_sitesList = new List <Sites> {
new Sites(), new Sites()
};
//if (sw1 != null)
//{
_type = partType;
if (_type == "prom")
{
imgType.Source = SurfaceWindow1.BitmapToImageSource(Resource1.sbol_prom2);
//Background = Brushes.Orange;
}
else if (_type == "rbs")
{
imgType.Source = SurfaceWindow1.BitmapToImageSource(Resource1.sbol_rbs2);
//Background = Brushes.DodgerBlue;
}
else if (_type == "cds")
{
imgType.Source = SurfaceWindow1.BitmapToImageSource(Resource1.sbol_cds2);
_sitesList.ElementAt(0).copySitesInfoFrom(new Sites("aatg"));
//Background = Brushes.Green;
}
else //type == "term"
{
imgType.Source = SurfaceWindow1.BitmapToImageSource(Resource1.sbol_term2);
//Background = Brushes.Red;
}
//}
//else
//{
// imgType.Source = SurfaceWindow1.BitmapToImageSource(Resource1.sbol_prom);
// this.Background = Brushes.Orange;
//}
_myRegDS = new RegDataSheet();
_progressBarWrapper = new ProgressBarWrapper(new Action(showProgressBar), new Action(hideProgressBar));
_myRegDS.BasicInfo.Sequence = "atgcatgctagcatccattacgatccgtcag";
}
public PrimerDesigner1(UIElement[][] partSiteSetsFromPD2)
{
InitializeComponent();
Part.pd1 = this;
SurfaceWindow1.pd1 = this;
_partSiteSets = partSiteSetsFromPD2;
_progressBarWrapper = new ProgressBarWrapper(new Action(showProgressBar), new Action(hideProgressBar));
//Populate showPanel with elements grouped into StackPanels
//Grouping helps determine which Parts and Sites data to display when one member is selected
StackPanel firstPanel = new StackPanel();
firstPanel.Children.Add(_partSiteSets[0][0]);
showPanel.Children.Add(firstPanel);
firstPanel.Visibility = Visibility.Collapsed;
for (int i = 1; i < _partSiteSets.Count() - 1; i++)
{
StackPanel set = new StackPanel();
foreach (UIElement element in _partSiteSets[i])
{
set.Children.Add(element);
}
showPanel.Children.Add(set);
}
StackPanel lastPanel = new StackPanel();
lastPanel.Children.Add(_partSiteSets[_partSiteSets.Count() - 1][0]);
showPanel.Children.Add(lastPanel);
lastPanel.Visibility = Visibility.Collapsed;
foreach (StackPanel sp in showPanel.Children)
{
foreach (UIElement elem in sp.Children)
{
elem.IsManipulationEnabled = false;
}
sp.Orientation = System.Windows.Controls.Orientation.Horizontal;
sp.Background = new SolidColorBrush(Colors.Transparent);
sp.Margin = new Thickness(3);
}
//Currently, show first part
showSetData(0, _l0PrimerList);
}
public Level0()
{
InitializeComponent();
Width = 1920;
Height = 1080;
Center = new Point(Width / 2.0, Height / 2.0);
IsTopmostOnActivation = false;
Part.l0 = this;
//Create String[] containing filter names for each part; add to partsFilters for later reference
String[] promFilters = { "inducible", "constitutive", "repressible", "multiple" };
String[] rbsFilters = { "anderson", "community", "isaacs", "rackham", "miscellaneous" };
String[] cdsFilters = { "reporter", "transcriptional", "selection marker", "protease", "post-translational modification", "DNA modification", "membrane proteins", "receptors/ligands", "lysis protein", "biosynthesis" }; //Add separate categories later
String[] termFilters = { "forward", "bidirectional", "reverse" };
String[] emptyFilters = { };
partsFilters = new String[5][];
partsFilters[0] = promFilters;
partsFilters[1] = rbsFilters;
partsFilters[2] = cdsFilters;
partsFilters[3] = termFilters;
partsFilters[4] = emptyFilters;
//Initialize progress bar
_progressBarWrapper = new ProgressBarWrapper(new Action(showProgressBar), new Action(hideProgressBar));
//Create arrays of Parts
//String loc = Directory.GetCurrentDirectory();
//loc = loc.Substring(0, loc.IndexOf("bin"));
//promotersList = createPartsList(loc + "promoters.txt");
//rbsList = createPartsList(loc + "rbs.txt");
//cdsList = createPartsList(loc + "cds.txt");
//terminatorsList = createPartsList(loc + "terminators.txt");
//Start with promoters
//_partTypeSelected = "prom";
//filterText = "inducible";
prom.IsChecked = true;
//populate_Filters(0);
//SurfaceRadioButton firstfilter = VisualTreeHelper.GetChild(filtersPanel, 0) as SurfaceRadioButton;
//firstfilter.IsChecked = true;
}
//Populates showPanels with L1 StackPanels that hold 1-4 L0 StackPanels that hold 1 Part and 2 Sites
//Grouping into set0s organizes data for L0 PCR products and destination vectors
//Grouping into set1s organizes data for L1 PCR products (LacZ?) and destination vectors
public PrimerDesigner1(List <List <Part> > partListFromPD2)
{
InitializeComponent();
Part.pd1 = this;
SurfaceWindow1.pd1 = this;
_partList = partListFromPD2;
_progressBarWrapper = new ProgressBarWrapper(new Action(showProgressBar), new Action(hideProgressBar));
/* NOTE: Removing duplicate fusion site visuals is MAD HACK right now, and I know that it's totally wrong and lazy fix. Will have to put in
* counters and conditionals to figure out when the last part of the last subpart list is to add in that last fusion site. Also need to somehow
* preserve the fusion site sequence string so it'll display the correct sequence with double fusion site SEQUENCE still there.
* SHOOT ME IN THE HEAD @T.Feng (will come back to this after dinner)*/
int partCounter = 0;
int sublistCounter = 0;
foreach (List <Part> sublist in _partList)
{
StackPanel set1 = new StackPanel();
set1.Orientation = System.Windows.Controls.Orientation.Horizontal;
foreach (Part p in sublist)
{
StackPanel set0 = new StackPanel();
set0.Orientation = System.Windows.Controls.Orientation.Horizontal;
set0.Background = new SolidColorBrush(Colors.Transparent);
Sites s1 = p.SitesList.ElementAt(0).clone();
s1.IsManipulationEnabled = false;
set0.Children.Add(s1);
set0.Children.Add(p);
set1.Children.Add(set0);
//if iteration is on last part of entire _partList, add second fusion site to end
if ((partCounter == sublist.Count - 1) && (sublistCounter == _partList.Count - 1))
{
Sites s2 = p.SitesList.ElementAt(1).clone();
s2.IsManipulationEnabled = false;
set0.Children.Add(s2);
}
//Generate primers for the Part PCR product and L0 DV and add to list
if (_partPrimerList == null)
{
_partPrimerList = new List <List <String> >();
}
_partPrimerList.Add(generatePrimers(-1, set0));
if (_l0PrimerList == null)
{
_l0PrimerList = new List <List <String> >();
}
_l0PrimerList.Add(generatePrimers(0, set0));
partCounter++;
}
showPanel.Children.Add(set1);
//If more than one Part in sublist, generate primers for the L1 DV and add to list
if (sublist.Count > 1)
{
if (_l1PrimerList == null)
{
_l1PrimerList = new List <List <String> >();
}
_l1PrimerList.Add(generatePrimers(1, set1));
l1DV.IsEnabled = true;
l1DV.Visibility = Visibility.Visible;
}
partCounter = 0;
sublistCounter++;
//If more than one sublist/L1 module in _partList, generate primers for the L2 DV and add to list
}
if (_partList.Count > 1)
{
if (_l2PrimerList == null)
{
_l2PrimerList = new List <List <String> >();
}
_l2PrimerList.Add(generatePrimers(2, showPanel));
l2DV.IsEnabled = true;
l2DV.Visibility = Visibility.Visible;
}
//On initialization, auto-select first Part
StackPanel show = (StackPanel)VisualTreeHelper.GetChild(VisualTreeHelper.GetChild(showPanel, 0), 0);
show.Background = new SolidColorBrush(Colors.WhiteSmoke);
pcr.IsChecked = true;
}