コード例 #1
0
        public void TryStitch_MergeReadsSmall()
        {
            //Migrated from old Pisces: Originally called Pisces_MergeReadsSmall

            //test1: happy path

            //0 1 2 3 4 5 6 7 8 9
            //- C A T A T
            //- - - - A T A G G

            var read1 = ReadTestHelper.CreateRead("chr1", "CATAT", 1, new CigarAlignment("5M"), new byte[] { 1, 2, 3, 4, 5 }, 4);

            StitcherTestHelpers.SetReadDirections(read1, DirectionType.Forward);

            var read2 = ReadTestHelper.CreateRead("chr1", "ATAGG", 4, new CigarAlignment("5M"), new byte[] { 1, 20, 30, 40, 50 }, 1);

            StitcherTestHelpers.SetReadDirections(read2, DirectionType.Reverse);

            var alignmentSet = new AlignmentSet(read1, read2);
            var stitcher     = StitcherTestHelpers.GetStitcher(10, nifyDisagreements: false);

            stitcher.TryStitch(alignmentSet);

            TestSuccesfullyStitchedRead(read1, read2, 0, "8M", (mergedRead) =>
            {
                Assert.Equal(mergedRead.Sequence, "CATATAGG");
                StitcherTestHelpers.CompareQuality(new byte[] { 1, 2, 3, 5, 25, 30, 40, 50 }, mergedRead.Qualities);
                var expectedDirections = StitcherTestHelpers.BuildDirectionMap(new List <IEnumerable <DirectionType> >
                {
                    StitcherTestHelpers.BuildDirectionSegment(DirectionType.Forward, 3),
                    StitcherTestHelpers.BuildDirectionSegment(DirectionType.Stitched, 2),
                    StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 3)
                });
                StitcherTestHelpers.VerifyDirectionType(expectedDirections, mergedRead.CigarDirections.Expand().ToArray());
            });

            //test2: different bases, one with low Q

            //0 1 2 3 4 5 6 7 8 9
            //- C A T A G
            //- - - - A T A G G

            read1 = ReadTestHelper.CreateRead("chr1", "CATAG", 1, new CigarAlignment("5M"), new byte[] { 1, 2, 3, 4, 5 }, 4);
            StitcherTestHelpers.SetReadDirections(read1, DirectionType.Reverse);

            read2 = ReadTestHelper.CreateRead("chr1", "ATAGG", 4, new CigarAlignment("5M"), new byte[] { 1, 20, 30, 40, 50 },
                                              1);
            StitcherTestHelpers.SetReadDirections(read2, DirectionType.Forward);


            TestSuccesfullyStitchedRead(read1, read2, 10, "8M", (mergedRead) =>
            {
                Assert.NotNull(mergedRead);

                Assert.Equal("CATATAGG", mergedRead.Sequence);
                StitcherTestHelpers.CompareQuality(new byte[] { 1, 2, 3, 5, 20, 30, 40, 50 }, mergedRead.Qualities);

                var expectedDirections = StitcherTestHelpers.BuildDirectionMap(new List <IEnumerable <DirectionType> >
                {
                    StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 3),
                    StitcherTestHelpers.BuildDirectionSegment(DirectionType.Stitched, 2),
                    StitcherTestHelpers.BuildDirectionSegment(DirectionType.Forward, 3)
                });
                StitcherTestHelpers.VerifyDirectionType(expectedDirections, mergedRead.CigarDirections.Expand().ToArray());
            });

            //test3: different bases, both with high Q

            //0 1 2 3 4 5 6 7 8 9
            //- C A T A G
            //- - - - A T A G G

            read1 = ReadTestHelper.CreateRead("chr1", "CATAG", 1, new CigarAlignment("5M"), new byte[] { 50, 92, 92, 92, 92 }, 4);
            read2 = ReadTestHelper.CreateRead("chr1", "ATAGG", 4, new CigarAlignment("5M"), new byte[] { 2, 20, 30, 40, 50 }, 1);

            StitcherTestHelpers.SetReadDirections(read1, DirectionType.Forward);
            StitcherTestHelpers.SetReadDirections(read2, DirectionType.Reverse);

            TestSuccesfullyStitchedRead(read1, read2, 10, "8M", (mergedRead) =>
            {
                Assert.NotNull(mergedRead);

                Assert.Equal("CATANAGG", mergedRead.Sequence);

                StitcherTestHelpers.CompareQuality(new byte[] { 50, 92, 92, 93, 0, 30, 40, 50 }, mergedRead.Qualities);
                var expectedDirections = StitcherTestHelpers.BuildDirectionMap(new List <IEnumerable <DirectionType> >
                {
                    StitcherTestHelpers.BuildDirectionSegment(DirectionType.Forward, 3),
                    StitcherTestHelpers.BuildDirectionSegment(DirectionType.Stitched, 2),
                    StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 3)
                });
                StitcherTestHelpers.VerifyDirectionType(expectedDirections, mergedRead.CigarDirections.Expand().ToArray());
            }, nifyDisagreements: true);
        }
コード例 #2
0
ファイル: BasicStitcherTests.cs プロジェクト: snashraf/Pisces
        public void TryStitch_ReCo()
        {
            // Real example from ReCo, was failing to generate the correct stitched cigar
            var read1Bases =
                "GTACTCCTACAGTCCCACCCCTCCCCTATAAACCTTATGAATCCCCGTTCACTTAGATGCCAGCTTGGCAAGGAAGGGAAGTACACATCTGTTGACAGTAATGAAATATCCTTGATAAGGATTTAAATTTTGGATGTGCTG";
            var read2Bases =
                "ACCTACAGTCCCACCCCTCCCCTATAAACCTTAGGAATCCCCGTTCACTTAGATGCCAGCTTGGCAAGGAAGGGAAGTACACATCTGTTGACAGTAATGAAATATCCTTGATAAGGATTTAAATTTTGGATGTGCTGAGCT";

            // 8             9
            // 3 4 5 6 7 8 9 0 1 2
            // s s s s s M M M M M ...
            // - - - - M M M M M M ...
            // F F F F R S S S S S ... // Stitched directions if we don't allow softclip to contribute
            // F F F F S S S S S S ... // Stitched directions if we do allow softclip to contribute

            var read1 = DomainTestHelper.CreateRead("chr21", read1Bases, 16685488,
                                                    new CigarAlignment("5S136M"));

            var read2 = DomainTestHelper.CreateRead("chr21", read2Bases, 16685487,
                                                    new CigarAlignment("137M4S"));

            StitcherTestHelpers.SetReadDirections(read2, DirectionType.Reverse);

            var stitcher     = new BasicStitcher(10, useSoftclippedBases: false);
            var alignmentSet = new AlignmentSet(read1, read2);

            stitcher.TryStitch(alignmentSet);
            // Without allowing softclips to count to support, should still get a M at an M/S overlap, but it won't be stitched.
            var mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet);

            Assert.Equal("4S137M4S", mergedRead.CigarData.ToString());
            var expectedDirections = StitcherTestHelpers.BuildDirectionMap(new List <IEnumerable <DirectionType> >
            {
                StitcherTestHelpers.BuildDirectionSegment(DirectionType.Forward, 4),
                StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 1),
                StitcherTestHelpers.BuildDirectionSegment(DirectionType.Stitched, 136),
                StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 4)
            });

            StitcherTestHelpers.VerifyDirectionType(expectedDirections, mergedRead.CigarDirections.Expand().ToArray());

            stitcher     = new BasicStitcher(10, useSoftclippedBases: true);
            alignmentSet = new AlignmentSet(read1, read2);
            stitcher.TryStitch(alignmentSet);
            mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet);
            Assert.Equal("4S137M4S", mergedRead.CigarData.ToString());
            expectedDirections = StitcherTestHelpers.BuildDirectionMap(new List <IEnumerable <DirectionType> >
            {
                StitcherTestHelpers.BuildDirectionSegment(DirectionType.Forward, 4),
                StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 1),
                StitcherTestHelpers.BuildDirectionSegment(DirectionType.Stitched, 136),
                StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 4)
            });
            StitcherTestHelpers.VerifyDirectionType(expectedDirections, mergedRead.CigarDirections.Expand().ToArray());

            // If we're not ignoring probe softclips, go back to the original expected directions (1 more stitched from probe)
            stitcher     = new BasicStitcher(10, useSoftclippedBases: true, ignoreProbeSoftclips: false);
            alignmentSet = new AlignmentSet(read1, read2);
            stitcher.TryStitch(alignmentSet);
            mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet);
            Assert.Equal("4S137M4S", mergedRead.CigarData.ToString());
            expectedDirections = StitcherTestHelpers.BuildDirectionMap(new List <IEnumerable <DirectionType> >
            {
                StitcherTestHelpers.BuildDirectionSegment(DirectionType.Forward, 4),
                StitcherTestHelpers.BuildDirectionSegment(DirectionType.Stitched, 137),
                StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 4)
            });
            StitcherTestHelpers.VerifyDirectionType(expectedDirections, mergedRead.CigarDirections.Expand().ToArray());
        }