public void TryStitch_MergeReadsSmall()
{
//Migrated from old Pisces: Originally called Pisces_MergeReadsSmall
//test1: happy path
//0 1 2 3 4 5 6 7 8 9
//- C A T A T
//- - - - A T A G G
var read1 = ReadTestHelper.CreateRead("chr1", "CATAT", 1, new CigarAlignment("5M"), new byte[] { 1, 2, 3, 4, 5 }, 4);
StitcherTestHelpers.SetReadDirections(read1, DirectionType.Forward);
var read2 = ReadTestHelper.CreateRead("chr1", "ATAGG", 4, new CigarAlignment("5M"), new byte[] { 1, 20, 30, 40, 50 }, 1);
StitcherTestHelpers.SetReadDirections(read2, DirectionType.Reverse);
var alignmentSet = new AlignmentSet(read1, read2);
var stitcher = StitcherTestHelpers.GetStitcher(10, nifyDisagreements: false);
stitcher.TryStitch(alignmentSet);
TestSuccesfullyStitchedRead(read1, read2, 0, "8M", (mergedRead) =>
{
Assert.Equal(mergedRead.Sequence, "CATATAGG");
StitcherTestHelpers.CompareQuality(new byte[] { 1, 2, 3, 5, 25, 30, 40, 50 }, mergedRead.Qualities);
var expectedDirections = StitcherTestHelpers.BuildDirectionMap(new List <IEnumerable <DirectionType> >
{
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Forward, 3),
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Stitched, 2),
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 3)
});
StitcherTestHelpers.VerifyDirectionType(expectedDirections, mergedRead.CigarDirections.Expand().ToArray());
});
//test2: different bases, one with low Q
//0 1 2 3 4 5 6 7 8 9
//- C A T A G
//- - - - A T A G G
read1 = ReadTestHelper.CreateRead("chr1", "CATAG", 1, new CigarAlignment("5M"), new byte[] { 1, 2, 3, 4, 5 }, 4);
StitcherTestHelpers.SetReadDirections(read1, DirectionType.Reverse);
read2 = ReadTestHelper.CreateRead("chr1", "ATAGG", 4, new CigarAlignment("5M"), new byte[] { 1, 20, 30, 40, 50 },
1);
StitcherTestHelpers.SetReadDirections(read2, DirectionType.Forward);
TestSuccesfullyStitchedRead(read1, read2, 10, "8M", (mergedRead) =>
{
Assert.NotNull(mergedRead);
Assert.Equal("CATATAGG", mergedRead.Sequence);
StitcherTestHelpers.CompareQuality(new byte[] { 1, 2, 3, 5, 20, 30, 40, 50 }, mergedRead.Qualities);
var expectedDirections = StitcherTestHelpers.BuildDirectionMap(new List <IEnumerable <DirectionType> >
{
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 3),
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Stitched, 2),
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Forward, 3)
});
StitcherTestHelpers.VerifyDirectionType(expectedDirections, mergedRead.CigarDirections.Expand().ToArray());
});
//test3: different bases, both with high Q
//0 1 2 3 4 5 6 7 8 9
//- C A T A G
//- - - - A T A G G
read1 = ReadTestHelper.CreateRead("chr1", "CATAG", 1, new CigarAlignment("5M"), new byte[] { 50, 92, 92, 92, 92 }, 4);
read2 = ReadTestHelper.CreateRead("chr1", "ATAGG", 4, new CigarAlignment("5M"), new byte[] { 2, 20, 30, 40, 50 }, 1);
StitcherTestHelpers.SetReadDirections(read1, DirectionType.Forward);
StitcherTestHelpers.SetReadDirections(read2, DirectionType.Reverse);
TestSuccesfullyStitchedRead(read1, read2, 10, "8M", (mergedRead) =>
{
Assert.NotNull(mergedRead);
Assert.Equal("CATANAGG", mergedRead.Sequence);
StitcherTestHelpers.CompareQuality(new byte[] { 50, 92, 92, 93, 0, 30, 40, 50 }, mergedRead.Qualities);
var expectedDirections = StitcherTestHelpers.BuildDirectionMap(new List <IEnumerable <DirectionType> >
{
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Forward, 3),
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Stitched, 2),
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 3)
});
StitcherTestHelpers.VerifyDirectionType(expectedDirections, mergedRead.CigarDirections.Expand().ToArray());
}, nifyDisagreements: true);
}
public void TryStitch_ReCo()
{
// Real example from ReCo, was failing to generate the correct stitched cigar
var read1Bases =
"GTACTCCTACAGTCCCACCCCTCCCCTATAAACCTTATGAATCCCCGTTCACTTAGATGCCAGCTTGGCAAGGAAGGGAAGTACACATCTGTTGACAGTAATGAAATATCCTTGATAAGGATTTAAATTTTGGATGTGCTG";
var read2Bases =
"ACCTACAGTCCCACCCCTCCCCTATAAACCTTAGGAATCCCCGTTCACTTAGATGCCAGCTTGGCAAGGAAGGGAAGTACACATCTGTTGACAGTAATGAAATATCCTTGATAAGGATTTAAATTTTGGATGTGCTGAGCT";
// 8 9
// 3 4 5 6 7 8 9 0 1 2
// s s s s s M M M M M ...
// - - - - M M M M M M ...
// F F F F R S S S S S ... // Stitched directions if we don't allow softclip to contribute
// F F F F S S S S S S ... // Stitched directions if we do allow softclip to contribute
var read1 = DomainTestHelper.CreateRead("chr21", read1Bases, 16685488,
new CigarAlignment("5S136M"));
var read2 = DomainTestHelper.CreateRead("chr21", read2Bases, 16685487,
new CigarAlignment("137M4S"));
StitcherTestHelpers.SetReadDirections(read2, DirectionType.Reverse);
var stitcher = new BasicStitcher(10, useSoftclippedBases: false);
var alignmentSet = new AlignmentSet(read1, read2);
stitcher.TryStitch(alignmentSet);
// Without allowing softclips to count to support, should still get a M at an M/S overlap, but it won't be stitched.
var mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet);
Assert.Equal("4S137M4S", mergedRead.CigarData.ToString());
var expectedDirections = StitcherTestHelpers.BuildDirectionMap(new List <IEnumerable <DirectionType> >
{
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Forward, 4),
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 1),
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Stitched, 136),
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 4)
});
StitcherTestHelpers.VerifyDirectionType(expectedDirections, mergedRead.CigarDirections.Expand().ToArray());
stitcher = new BasicStitcher(10, useSoftclippedBases: true);
alignmentSet = new AlignmentSet(read1, read2);
stitcher.TryStitch(alignmentSet);
mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet);
Assert.Equal("4S137M4S", mergedRead.CigarData.ToString());
expectedDirections = StitcherTestHelpers.BuildDirectionMap(new List <IEnumerable <DirectionType> >
{
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Forward, 4),
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 1),
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Stitched, 136),
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 4)
});
StitcherTestHelpers.VerifyDirectionType(expectedDirections, mergedRead.CigarDirections.Expand().ToArray());
// If we're not ignoring probe softclips, go back to the original expected directions (1 more stitched from probe)
stitcher = new BasicStitcher(10, useSoftclippedBases: true, ignoreProbeSoftclips: false);
alignmentSet = new AlignmentSet(read1, read2);
stitcher.TryStitch(alignmentSet);
mergedRead = StitcherTestHelpers.GetMergedRead(alignmentSet);
Assert.Equal("4S137M4S", mergedRead.CigarData.ToString());
expectedDirections = StitcherTestHelpers.BuildDirectionMap(new List <IEnumerable <DirectionType> >
{
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Forward, 4),
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Stitched, 137),
StitcherTestHelpers.BuildDirectionSegment(DirectionType.Reverse, 4)
});
StitcherTestHelpers.VerifyDirectionType(expectedDirections, mergedRead.CigarDirections.Expand().ToArray());
}