private void select_Sequence(object sender, RoutedEventArgs e)
{
String s = "";
foreach (UIElement l1 in this.Children)
{
if (l1.GetType() == typeof(L1Module))
{
foreach (UIElement p in ((L1Module)l1).L1Grid.Children)
{
if (p.GetType() == typeof(Part))
{
s = s + ((Part)p).myRegDS.BasicInfo.Sequence + "\n";
}
}
}
}
TextBlock sequence = new TextBlock();
sequence.Text = s;
ScatterViewItem svi = new ScatterViewItem();
svi.ContainerManipulationCompleted += new ContainerManipulationCompletedEventHandler(seq_ContainerManipulationCompleted);
svi.Content = sequence;
SurfaceWindow1.addData(sender, svi);
}
/// <summary>
/// Initialize SitesAdded array to proper size based on Part/L1Module/L2Module to accommodate all possible fusion sites.
/// Actual fusion site requirement checking done in Sites.xaml.cs during hit test
/// </summary>
/// @T.Feng
//private void initializeFusionSiteChecker()
//{
// switch (_moduleNum)
// {
// case 0: SitesAdded = new Sites[2]; break;//Part has 2 fusion sites
// case 1: SitesAdded = new Sites[5]; break;//L1Module has 5 fusion sites
// case 2: SitesAdded = new Sites[_l2Modulel1Count * 4 + 1]; break; //L2Module has L1ModuleNum*4 + 1 fusion sites
// default: Console.WriteLine("No fusion site-added storage constructed, no info on object that launched Primer Designer. PrimerDesigner2.xaml.cs Ln 250"); break;
// }
//}
#endregion
protected override void OnInitialized(EventArgs e)
{
base.OnInitialized(e);
DataContext = this;
_fusionSiteLibrary = new List <Sites>();
//_fusionSiteLibrary.Add(new Sites("Site A", "acaa", new SolidColorBrush(Colors.Gold)));
//_fusionSiteLibrary.Add(new Sites("Site B", "atgc", new SolidColorBrush(Colors.GreenYellow)));
//Sites tester = new Sites("Site C", "atgg", new SolidColorBrush(Colors.LimeGreen));
//_fusionSiteLibrary.Add(tester);
//_fusionSiteLibrary.Add(new Sites("Site D", "gtca", new SolidColorBrush(Colors.Orchid)));
//_fusionSiteLibrary.Add(new Sites("Site E", "cctg", new SolidColorBrush(Colors.PaleVioletRed)));
//_fusionSiteLibrary.Add(new Sites("Site F", "aatg", new SolidColorBrush(Colors.Peru)));
//_fusionSiteLibrary.Add(new Sites("Site G", "ggta", new SolidColorBrush(Colors.RosyBrown)));
//_fusionSiteLibrary.Add(new Sites("Site H", "catt", new SolidColorBrush(Colors.Thistle)));
//_fusionSiteLibrary.Add(new Sites("Site I", "gact", new SolidColorBrush(Colors.DeepSkyBlue)));
_fusionSiteLibrary.Add(new Sites("acaa"));
_fusionSiteLibrary.Add(new Sites("atgc"));
_fusionSiteLibrary.Add(new Sites("atgg"));
_fusionSiteLibrary.Add(new Sites("gtca"));
_fusionSiteLibrary.Add(new Sites("cctg"));
_fusionSiteLibrary.Add(new Sites("ggta"));
_fusionSiteLibrary.Add(new Sites("catt"));
_fusionSiteLibrary.Add(new Sites("gact"));
foreach (Sites s in _fusionSiteLibrary)
{
PD2_siteLibrary.Items.Add(s);
s.Center = SurfaceWindow1.SetPosition(s);
}
}
//Method for generating the Sequence scatterview item from the element menu
private void select_Sequence(object sender, RoutedEventArgs e)
{
_thisRegDS = new RegDataSheet("http://partsregistry.org/wiki/index.php?title=Part:" + this.partName.Text);
seq = new ScatterViewItem();
seq.CanRotate = false;
seq.CanScale = false;
TextBlock seqtext = new TextBlock(); //Creates a textblock to be inserted into the scatterview
seqtext.Margin = new Thickness(10);
seq.Background = Brushes.SteelBlue;
seqtext.Background = Brushes.White;
seq.Width = 800;
seq.MinHeight = 600;
seqtext.Width = 790;
seqtext.MinHeight = 590;
seqtext.Text = "Parts Registry ID: " + _thisRegDS.Name + "\n" + "\n" + "Sequence:" + "\n" + "\n" + _thisRegDS.BasicInfo.Sequence;
seq.Content = seqtext;
SurfaceWindow1.addData(sender, seq);
seq.ContainerManipulationCompleted += new ContainerManipulationCompletedEventHandler(onSeqManipulationCompleted); //Event handler that allows trashing when swiped to the right
seq.Orientation = 0;
//Overwrites center calculated in addData(); consider checking out later
Point PartCenter = this.Center;
Point OriginalCenter = seq.Center;
OriginalCenter.X = (PartCenter.X);
OriginalCenter.Y = (PartCenter.Y + 370);
seq.Center = OriginalCenter;
}
//Removes from current parent and adds to destination parent at same location
private void changeParents_SV(ScatterView parentSV, ScatterView destination)
{
//Point newPoint = this.transformCoords(destination);
Point newPoint = SurfaceWindow1.transformCoords(this, destination);
parentSV.Items.Remove(this);
destination.Items.Add(this);
this.Center = newPoint;
}
//Adds an L1Module template to Manual
public void addL1Module()
{
L1Module l1 = new L1Module();
l1.Template.Visibility = System.Windows.Visibility.Visible;
L1_manTab.Items.Add(l1);
l1.Center = SurfaceWindow1.SetPosition(l1);
l1.IsManipulationEnabled = false;
}
//Testing out global variable checking with addition of new Parts
private void partAdder_Click(object sender, RoutedEventArgs e)
{
Part part = new Part();
ImageSourceConverter icon = new ImageSourceConverter();
part.partName.Text = "BBa##)@)#";
part.partCategory.Text = "no filter";
L0_resultsSV.Items.Add(part);
part.Center = SurfaceWindow1.SetPosition(part);
}
//Adds an editable fusion site template to the library
private void siteAdder_Click(object sender, RoutedEventArgs e)
{
Sites template = new Sites();
template.CircleText.IsReadOnly = false;
template.Height = 50;
template.Width = 50;
PD2_siteLibrary.Items.Add(template);
template.Center = SurfaceWindow1.SetPosition(template);
}
//Moves objects from parent to parent while maintaining a consistent center
private void changeParents_SV(ScatterView parentSV, ScatterView destinationSV)
{
try
{
Point newPoint = SurfaceWindow1.transformCoords(this, destinationSV);
parentSV.Items.Remove(this);
destinationSV.Items.Add(this);
this.Center = newPoint;
}
catch (Exception exc) { Console.WriteLine("changeParents_SV \n" + exc); }
}
//Stored separate from searchByFilter so it can be called by _progressBarWrapper as the long operation
//Returns a string to keep _progressBarWrapper happy
//private String searchByFilter_longOp(int filterIndex)
//{
// //Get list to populate from
// List<List<String>> sourceList;
// if (_partTypeSelected == "prom")
// {
// sourceList = promotersList;
// }
// else if (_partTypeSelected == "rbs")
// {
// sourceList = rbsList;
// }
// else if (_partTypeSelected == "cds")
// {
// sourceList = cdsList;
// }
// else //"term"
// {
// sourceList = terminatorsList;
// }
// //Find indexes to start and stop populating from in partsList[0]
// List<String> sourceIndexes = sourceList.ElementAt(0);
// int firstIndex = Convert.ToInt32(sourceIndexes.ElementAt(filterIndex));
// int lastIndex;
// //If filterIndex refers to the last index stored in sourceIndexes, i.e. the start of the last category
// if (filterIndex == sourceIndexes.Count - 1)
// { //lastIndex is the index of the last part stored in sourceList
// lastIndex = sourceList.Count - 1;
// }
// else
// { //Otherwise, lastIndex is the index of the last part before the start index of the next category
// lastIndex = Convert.ToInt32(sourceIndexes.ElementAt(filterIndex + 1)) - 1;
// }
// populate_Results(sourceList, firstIndex, lastIndex);
// return "I'm only here because threading wants a return type";
//}
//Populate L0_resultsSV with parts from partsList between given indexes
private void populate_Results(List <List <String> > partsList, int first, int last)
{
for (int i = first; i <= last; i++)
{
Part p = new Part();
p.Type = _partTypeSelected;
p.partName.Text = (partsList.ElementAt(i)).ElementAt(0);
p.partCategory.Text = (partsList.ElementAt(i)).ElementAt(1);
this.L0_resultsSV.Items.Add(p);
p.Center = SurfaceWindow1.SetPosition(p);
}
}
public BasicImageReceiver(SurfaceWindow1 surface)
{
IPAddress ipAdress = IPAddress.Parse(SurfaceWindow1.SURFACE);
//this.tcpListener = new TcpListener(IPAddress.Any, port);
this.tcpListener = new TcpListener(ipAdress, port);
Console.WriteLine("Server started; available at local IP: " + ipAdress);
this.surfaceWin = surface;
this.listenThread = new Thread(new ThreadStart(ListenForClients));
//this.listenThread.SetApartmentState(ApartmentState.MTA);
this.listenThread.Start();
//this.listenThread.Join();
}
//Creates a new Part based on RegDataSheet and category; do not add duplicates
private void partFromRegDS(RegDataSheet regDS, String cat)
{
String currentPartsList = listCurrentPartsInResults();
if (!currentPartsList.Contains(regDS.Name))
{
Part p = new Part(convertType_RDSToMCP(regDS.Type));
p.myRegDS = regDS;
p.partName.Text = p.myRegDS.Name;
p.partCategory.Text = p.myRegDS.BasicInfo.DescriptionName;
L0_resultsSV.Items.Add(p);
p.Center = SurfaceWindow1.SetPosition(p);
}
}
//Constructor for searches unbounded by part types
public Part(String partType)
{
InitializeComponent();
Orientation = 0;
CanScale = false;
CanRotate = false;
_sitesList = new List <Sites> {
new Sites(), new Sites()
};
//if (sw1 != null)
//{
_type = partType;
if (_type == "prom")
{
imgType.Source = SurfaceWindow1.BitmapToImageSource(Resource1.sbol_prom2);
//Background = Brushes.Orange;
}
else if (_type == "rbs")
{
imgType.Source = SurfaceWindow1.BitmapToImageSource(Resource1.sbol_rbs2);
//Background = Brushes.DodgerBlue;
}
else if (_type == "cds")
{
imgType.Source = SurfaceWindow1.BitmapToImageSource(Resource1.sbol_cds2);
_sitesList.ElementAt(0).copySitesInfoFrom(new Sites("aatg"));
//Background = Brushes.Green;
}
else //type == "term"
{
imgType.Source = SurfaceWindow1.BitmapToImageSource(Resource1.sbol_term2);
//Background = Brushes.Red;
}
//}
//else
//{
// imgType.Source = SurfaceWindow1.BitmapToImageSource(Resource1.sbol_prom);
// this.Background = Brushes.Orange;
//}
_myRegDS = new RegDataSheet();
_progressBarWrapper = new ProgressBarWrapper(new Action(showProgressBar), new Action(hideProgressBar));
_myRegDS.BasicInfo.Sequence = "atgcatgctagcatccattacgatccgtcag";
}
//When manipulation completed, check location for drop and transfer data to placeholder; then delete
private void Sites_ContainerManipulationCompleted(object sender, ContainerManipulationCompletedEventArgs e)
{
try
{
Sites s = sender as Sites;
if (myClone != null)
{
Point pt = SurfaceWindow1.transformCoords(this, pd2.PD2_manual);
if (pd2.PD2_buildTabs.SelectedIndex == 0) //If Manual is selected
{
VisualTreeHelper.HitTest(pd2.PD2_manual, null, new HitTestResultCallback(sitesCallback), new PointHitTestParameters(pt));
}
ScatterView parent = (ScatterView)s.Parent;
parent.Items.Remove(s);
}
}
catch (Exception exc) { Console.WriteLine(exc); }
}
/// <summary>
/// Empty placeholder part
/// </summary>
public L1Module()
{
InitializeComponent();
L1Prom.imgType.Source = SurfaceWindow1.BitmapToImageSource(Resource1.sbol_prom);
L1RBS.imgType.Source = SurfaceWindow1.BitmapToImageSource(Resource1.sbol_rbs);
L1CDS.imgType.Source = SurfaceWindow1.BitmapToImageSource(Resource1.sbol_cds);
L1Term.imgType.Source = SurfaceWindow1.BitmapToImageSource(Resource1.sbol_term);
foreach (UIElement p in L1Grid.Children)
{
if (p.GetType() == typeof(Part))
{
((Part)p).Opacity = 0.5;
//p.IsEnabled = false;
((Part)p).ShowsActivationEffects = false;
((Part)p).IsTopmostOnActivation = false;
((Part)p).ElementMenu.IsEnabled = false;
((Part)p).ElementMenu.Visibility = Visibility.Collapsed;
}
}
}
private void Sites_ContainerManipulationDelta(object sender, ContainerManipulationDeltaEventArgs e)
{
try
{
myClone = clone();
myClone.Center = originalCenter;
int i = pd2.FusionSiteLibrary.IndexOf(this);
Point newPoint = SurfaceWindow1.transformCoords(this, pd2.PD2_SV);
//pd2.SourceItems.Insert(i, copy);
//pd2.SourceItems.Remove(this);
pd2.PD2_siteLibrary.Items.Remove(this);
pd2.PD2_siteLibrary.Items.Add(myClone);
pd2.PD2_SV.Items.Add(this);
this.Center = newPoint;
this.ContainerManipulationDelta -= Sites_ContainerManipulationDelta;
}
catch (Exception exc) { Console.WriteLine(exc); }
}
//Places clone of dragged part into L1 if below threshold
private void PartInL0()
{
try
{
double yL1 = sw1.L1.Center.Y;
double yThreshold = yL1 - sw1.L1.Height / 2 - 180;
//Check if user is dropping or dumping
if (Center.Y > yThreshold)
{ //Create clone, check Part type, and place in appropriate L1 partsbox
Part L1clone = clone();
if (_type == "prom")
{
sw1.L1.L1_prom.Items.Add(L1clone);
}
else if (_type == "rbs")
{
sw1.L1.L1_rbs.Items.Add(L1clone);
}
else if (_type == "cds")
{
sw1.L1.L1_cds.Items.Add(L1clone);
}
else if (_type == "term")
{
sw1.L1.L1_term.Items.Add(L1clone);
}
L1clone.Center = SurfaceWindow1.SetPosition(L1clone);
Console.WriteLine("Part was added to L1");
}
else
{
myClone.IsManipulationEnabled = true;
myClone.Opacity = 1;
}
}
catch (Exception exc) { Console.WriteLine("PartInL0 \n" + exc); }
}
/// <summary>
/// Populated part: used in L1 & L2
/// NOT ACTUALLY USED. Copying over of Part information displays properly
/// only when copyPartInfoFram is called during the adding of permuted L1Modules to the permTabs.
/// </summary>
public L1Module(Part p, Part r, Part c, Part t)
{
InitializeComponent();
L1Prom.imgType.Source = SurfaceWindow1.BitmapToImageSource(Resource1.sbol_prom);
L1RBS.imgType.Source = SurfaceWindow1.BitmapToImageSource(Resource1.sbol_rbs);
L1CDS.imgType.Source = SurfaceWindow1.BitmapToImageSource(Resource1.sbol_cds);
L1Term.imgType.Source = SurfaceWindow1.BitmapToImageSource(Resource1.sbol_term);
L1Prom = p;
L1Prom.partName.Text = p.myRegDS.Name;
L1Prom.partCategory.Text = p.partCategory.Text;
//L1Prom.copyPartInfoFrom(p);
L1RBS = r;
L1RBS.partName.Text = r.myRegDS.Name;
//L1RBS.copyPartInfoFrom(r);
L1CDS = c;
//L1CDS.partName.Text = c.myRegDS.Name;
//L1RBS.copyPartInfoFrom(c);
L1Term = t;
//L1Term.partName.Text = t.myRegDS.Name;
//L1Term.copyPartInfoFrom(t);
}
//L1 behavior handler: drops L1Modules into L2
//Checks center against threshold value, below which drop occurs
//Currently handles Permutations functions of Level 2 (consider moving to L1ModuleInL2())
private void L1ModuleInL1()
{
ScatterView parent = Parent as ScatterView;
//Places item in L2 if user wants to drop it in
double yL1 = sw1.L1.Center.Y;
double yL2 = sw1.L2.Center.Y;
double yThreshold = yL2 - yL1 - 100; //For a 50 margin and 50 more because the center is relative to L1_SV
//Check if user is dropping or dumping
Point transformedCenter = SurfaceWindow1.transformCoords(this, sw1.L1.L1_SV);
if (transformedCenter.Y > yThreshold) //0 is the top relative to L1_xTabs; adjust accordingly. Need to fix this to a relative height.
{
L1Module cloneToL2 = clone();
sw1.L2.L2_L1ModulesSV.Items.Add(cloneToL2);
cloneToL2.Center = SurfaceWindow1.SetPosition(cloneToL2);
}
else
{ //Dumped; restore function to clone
myClone.IsManipulationEnabled = true;
myClone.Opacity = 1;
}
}
//L2 behavior handler: drops L1Modules into L2Modules
//Detects L2Modules via hittesting, using the center of the L1module as the initial value
private void L1ModuleInL2()
{
Point pt = SurfaceWindow1.transformCoords(this, sw1.L2.L2_manTab);
VisualTreeHelper.HitTest(sw1.L2.L2_manTab, null, new HitTestResultCallback(TargetL2MCallback), new PointHitTestParameters(pt));
if (targetL2Module != null)
{ //Dropped
L1Module manTabClone = clone();
manTabClone.IsManipulationEnabled = false;
manTabClone.targetL2Module = targetL2Module;
manTabClone.Background = sw1.L2.L1MColors.ElementAt(targetL2Module.Children.Count - 1);
manTabClone.BorderBrush = manTabClone.Background;
//If targetL2M only contains an element menu, add margin to left
//This leaves space so L2M can be interacted with and element menu can be accessed; this isn't the way to do it. When switching order, margin moves too.
//if (targetL2Module.Children.Count == 1) manTabClone.Margin = new Thickness(30,0,0,0);
targetL2Module.Children.Add(manTabClone);
}
else
{ //Dumped; check if delete from palette
//Console.WriteLine("Missed!");
sw1.swipeToDelete(this);
}
}
//Reads in Part Registry ID and type from text file
private void populate_ResultsPage(string FilePath)
{
StreamReader reader = new StreamReader(FilePath);
while (reader.EndOfStream != true)
{
//Read in data
string ThisLine = reader.ReadLine();
string[] SplitLine = ThisLine.Split(',');
string CategorySplit = SplitLine[1].Trim();
string CommonNameSplit = (SplitLine[2].Trim()).Replace("&", "");
//Filter data, add Parts
if (CategorySplit == filterText)
{
Part p = new Part();
p.Type = _partTypeSelected;
p.partName.Text = SplitLine[0];
p.partCategory.Text = CommonNameSplit;
this.L0_resultsSV.Items.Add(p);
p.Center = SurfaceWindow1.SetPosition(p);
}
}
}
private void select_DataSheet(object sender, RoutedEventArgs e)
{
//try
//{
//_thisRegDS = new RegDataSheet("http://partsregistry.org/wiki/index.php?title=Part:" + this.partName.Text);
ds = new MenuDataSheet();
ds.ContainerManipulationCompleted += new ContainerManipulationCompletedEventHandler(onDSManipulationCompleted);
if (_myRegDS.Name != "test") //Already got data from registry, so just populate from it
{
#region Populating the data sheet's datasheet
//Specifies the Length of the Sequence on the Sequence tab of the data sheet
int Length = _myRegDS.BasicInfo.Length;
TextBlock LengthBlock = new TextBlock();
//ds.SeqTab.Children.Add(LengthBlock);
LengthBlock.VerticalAlignment = VerticalAlignment.Top;
LengthBlock.Text = "Length: " + Length.ToString();
//This is all pulling information from the Reg Data Sheet associated with the part and inserting it in the data sheet
ds.PopulateDataSheet(_myRegDS.Name, 0, 1, ds.DataSheet, "datasheet");
ds.PopulateDataSheet(_myRegDS.BasicInfo.DescriptionName, 1, 1, ds.DataSheet, "datasheet");
ds.PopulateDataSheet(_myRegDS.Type, 2, 1, ds.DataSheet, "datasheet");
ds.PopulateDataSheet(_myRegDS.Promoter.getReg(), 3, 1, ds.DataSheet, "datasheet");
ds.PopulateDataSheet(_myRegDS.BasicInfo.Availability, 4, 1, ds.DataSheet, "datasheet");
ds.PopulateDataSheet(_myRegDS.BasicInfo.Usefulness, 5, 1, ds.DataSheet, "datasheet");
ds.PopulateDataSheet(_myRegDS.Description.assembCompString(), 6, 1, ds.DataSheet, "datasheet");
ds.PopulateDataSheet(_myRegDS.Description.chassisString(), 7, 1, ds.DataSheet, "datasheet");
//Specific to sequence tab
ds.PopulateDataSheet(_myRegDS.BasicInfo.Sequence, 1, 1, ds.SeqTab, "seq");
ds.PopulateDataSheet(Length.ToString(), 0, 1, ds.SeqTab, "length");
//Specific to AuthorInfo Tab
ds.PopulateDataSheet(_myRegDS.Reference.Author, 0, 1, ds.AuthorInfo, "author");
ds.PopulateDataSheet(_myRegDS.Reference.Group, 1, 1, ds.AuthorInfo, "author");
ds.PopulateDataSheet(_myRegDS.Reference.Date, 2, 1, ds.AuthorInfo, "author");
if (_myRegDS.Type == "rbs")
{
RowDefinition rowDef1 = new RowDefinition();
ds.DataSheet.RowDefinitions.Add(rowDef1);
ds.PopulateDataSheet(_myRegDS.Rbs.FamilyName, 8, 1, ds.DataSheet);
TextBlock RBSFam = new TextBlock();
RBSFam.Text = "Family";
ds.DataSheet.Children.Add(RBSFam);
Grid.SetRow(RBSFam, 8);
}
else if (_myRegDS.Type == "terminator")
{
RowDefinition rowDef1 = new RowDefinition();
RowDefinition rowDef2 = new RowDefinition();
RowDefinition rowDef3 = new RowDefinition();
RowDefinition rowDef4 = new RowDefinition();
ds.DataSheet.RowDefinitions.Add(rowDef1);
ds.DataSheet.RowDefinitions.Add(rowDef2);
ds.DataSheet.RowDefinitions.Add(rowDef3);
ds.DataSheet.RowDefinitions.Add(rowDef4);
TextBlock Direction = new TextBlock();
Direction.Text = "Direction";
Direction.FontSize = 18;
ds.DataSheet.Children.Add(Direction);
Grid.SetRow(Direction, 8);
ds.PopulateDataSheet(_myRegDS.Terminators.Direction, 8, 1, ds.DataSheet);
ds.PopulateDataSheet(_myRegDS.Terminators.ForwardEff, 9, 1, ds.DataSheet);
ds.PopulateDataSheet(_myRegDS.Terminators.ReversedEff, 10, 1, ds.DataSheet);
ds.PopulateDataSheet(_myRegDS.Terminators.ReversedVers, 11, 1, ds.DataSheet);
}
#endregion
#region Populating Publications
Func <String, PubList> _GetPublications =
delegate(String id) { return(new PubList(id)); };
Action <PubList> callback = delegate(PubList result)
{
//_thisRegDS = new RegDataSheet("http://partsregistry.org/wiki/index.php?title=Part:" + this.partName.Text);
int m = 0;
if (result.Titles.Count == 0)
{
int Count = result.Titles.Count;
SurfaceListBoxItem NoResults = new SurfaceListBoxItem();
TextBlock Content = new TextBlock();
Content.Text = "No Results Found";
NoResults.Content = Content;
ds.Publictions.Items.Add(NoResults);
}
if (result.Titles.Count > 0)
{
int TotalArticles = result.Titles.Count;
SurfaceListBoxItem ArticleCount = new SurfaceListBoxItem();
TextBlock CountContent = new TextBlock();
CountContent.Text = "Results Found: " + TotalArticles as string;
ArticleCount.Content = CountContent;
ds.Publictions.Items.Add(ArticleCount);
}
foreach (String Titles in result.Titles)
{
//To Test if titles are actually adding
SurfaceListBoxItem item = new SurfaceListBoxItem();
TextBlock PubTitles = new TextBlock();
item.Selected += new RoutedEventHandler(item_Selected);
item.Content = Titles;
PubTitles.Tag = result.Links.ElementAt(m);
//item.Tag = result.Authors.ElementAt(m);
ds.Publictions.Items.Add(item);
RowDefinition rowDef1 = new RowDefinition();
RowDefinition rowDef2 = new RowDefinition();
RowDefinition rowDef3 = new RowDefinition();
RowDefinition rowDef4 = new RowDefinition();
abs = new PubAbstract(PubTitles.Tag as string, result.getAuthors());
item.Tag = "Title: " + item.Content as string + "\r\n" + "\r\n" + "\r\n"
+ "Authors: " + result.Authors.ElementAt(m) as string + "\r\n" + "\r\n"
+ "Abstract:" + "\r\n" + "\r\n"
+ abs.getAbstract() as string;
m += 1;
Console.WriteLine(m);
if (m > 20)
{
break;
}
}
/*foreach (String Titles in result.Titles)
* {
* TextBlock Middle = new TextBlock();
* Middle.Text = Titles;
* //ds.Publications.Children.Add(Middle);
* Grid.SetRow(Middle, m);
* m += 1;
#endregion
* //publications location maybe
* //Creates a list of PubMed source related to the query
*
* }*/
};
_Publist = _progressBarWrapper.execute <String, PubList>(_GetPublications, _myRegDS.BasicInfo.DescriptionName, callback);
#endregion
SurfaceWindow1.addData(sender, ds);
}
else
{
Func <String, RegDataSheet> _getRegDataSheet =
delegate(String pName) { return(new RegDataSheet("http://partsregistry.org/wiki/index.php?title=Part:" + pName)); };
Action <RegDataSheet> _getRegDataSheetCallback = delegate(RegDataSheet _regDS)
{
_myRegDS = _regDS;
#region Populating the data sheet's datasheet
//Specifies the Length of the Sequence on the Sequence tab of the data sheet
int Length = _myRegDS.BasicInfo.Length;
TextBlock LengthBlock = new TextBlock();
//ds.SeqTab.Children.Add(LengthBlock);
LengthBlock.VerticalAlignment = VerticalAlignment.Top;
LengthBlock.Text = "Length: " + Length.ToString();
//This is all pulling information from the Reg Data Sheet associated with the part and inserting it in the data sheet
ds.PopulateDataSheet(_myRegDS.Name, 0, 1, ds.DataSheet, "datasheet");
ds.PopulateDataSheet(_myRegDS.BasicInfo.DescriptionName, 1, 1, ds.DataSheet, "datasheet");
ds.PopulateDataSheet(_myRegDS.Type, 2, 1, ds.DataSheet, "datasheet");
ds.PopulateDataSheet(_myRegDS.Promoter.getReg(), 3, 1, ds.DataSheet, "datasheet");
ds.PopulateDataSheet(_myRegDS.BasicInfo.Availability, 4, 1, ds.DataSheet, "datasheet");
ds.PopulateDataSheet(_myRegDS.BasicInfo.Usefulness, 5, 1, ds.DataSheet, "datasheet");
ds.PopulateDataSheet(_myRegDS.Description.assembCompString(), 6, 1, ds.DataSheet, "datasheet");
ds.PopulateDataSheet(_myRegDS.Description.chassisString(), 7, 1, ds.DataSheet, "datasheet");
//Specific to sequence tab
ds.PopulateDataSheet(_myRegDS.BasicInfo.Sequence, 1, 1, ds.SeqTab, "seq");
ds.PopulateDataSheet(Length.ToString(), 0, 1, ds.SeqTab, "length");
//Specific to AuthorInfo Tab
ds.PopulateDataSheet(_myRegDS.Reference.Author, 0, 1, ds.AuthorInfo, "author");
ds.PopulateDataSheet(_myRegDS.Reference.Group, 1, 1, ds.AuthorInfo, "author");
ds.PopulateDataSheet(_myRegDS.Reference.Date, 2, 1, ds.AuthorInfo, "author");
if (_myRegDS.Type == "rbs")
{
RowDefinition rowDef1 = new RowDefinition();
ds.DataSheet.RowDefinitions.Add(rowDef1);
ds.PopulateDataSheet(_myRegDS.Rbs.FamilyName, 8, 1, ds.DataSheet);
TextBlock RBSFam = new TextBlock();
RBSFam.Text = "Family";
RBSFam.FontSize = 14;
RBSFam.FontWeight = FontWeights.Bold;
RBSFam.VerticalAlignment = VerticalAlignment.Top;
// COME BACK TO THIS LATER
ds.DataSheet.Children.Add(RBSFam);
Grid.SetRow(RBSFam, 8);
}
else if (_myRegDS.Type == "terminator")
{
RowDefinition rowDef1 = new RowDefinition();
RowDefinition rowDef2 = new RowDefinition();
RowDefinition rowDef3 = new RowDefinition();
RowDefinition rowDef4 = new RowDefinition();
ds.DataSheet.RowDefinitions.Add(rowDef1);
ds.DataSheet.RowDefinitions.Add(rowDef2);
ds.DataSheet.RowDefinitions.Add(rowDef3);
ds.DataSheet.RowDefinitions.Add(rowDef4);
TextBlock Direction = new TextBlock();
Direction.Text = "Direction";
Direction.FontSize = 18;
ds.DataSheet.Children.Add(Direction);
Grid.SetRow(Direction, 8);
ds.PopulateDataSheet(_myRegDS.Terminators.Direction, 8, 1, ds.DataSheet);
ds.PopulateDataSheet(_myRegDS.Terminators.ForwardEff, 9, 1, ds.DataSheet);
ds.PopulateDataSheet(_myRegDS.Terminators.ReversedEff, 10, 1, ds.DataSheet);
ds.PopulateDataSheet(_myRegDS.Terminators.ReversedVers, 11, 1, ds.DataSheet);
}
#endregion
#region Populating Publications
Func <String, PubList> _GetPublications =
delegate(String id) { return(new PubList(id)); };
Action <PubList> callback = delegate(PubList result)
{
//_thisRegDS = new RegDataSheet("http://partsregistry.org/wiki/index.php?title=Part:" + this.partName.Text);
int m = 0;
if (result.Titles.Count == 0)
{
int Count = result.Titles.Count;
SurfaceListBoxItem NoResults = new SurfaceListBoxItem();
TextBlock Content = new TextBlock();
Content.Text = "No Results Found";
NoResults.Content = Content;
ds.Publictions.Items.Add(NoResults);
}
if (result.Titles.Count > 0)
{
int TotalArticles = result.Titles.Count;
SurfaceListBoxItem ArticleCount = new SurfaceListBoxItem();
TextBlock CountContent = new TextBlock();
CountContent.Text = "Results Found: " + TotalArticles as string;
ArticleCount.Content = CountContent;
ds.Publictions.Items.Add(ArticleCount);
}
foreach (String Titles in result.Titles)
{
//To Test if titles are actually adding
SurfaceListBoxItem item = new SurfaceListBoxItem();
TextBlock PubTitles = new TextBlock();
item.Selected += new RoutedEventHandler(item_Selected);
item.Content = Titles;
PubTitles.Tag = result.Links.ElementAt(m);
//item.Tag = result.Authors.ElementAt(m);
ds.Publictions.Items.Add(item);
RowDefinition rowDef1 = new RowDefinition();
RowDefinition rowDef2 = new RowDefinition();
RowDefinition rowDef3 = new RowDefinition();
RowDefinition rowDef4 = new RowDefinition();
abs = new PubAbstract(PubTitles.Tag as string, result.getAuthors());
item.Tag = "Title: " + item.Content as string + "\r\n" + "\r\n" + "\r\n"
+ "Authors: " + result.Authors.ElementAt(m) as string + "\r\n" + "\r\n"
+ "Abstract:" + "\r\n" + "\r\n"
+ abs.getAbstract() as string;
m += 1;
Console.WriteLine(m);
if (m > 20)
{
break;
}
}
/*foreach (String Titles in result.Titles)
* {
* TextBlock Middle = new TextBlock();
* Middle.Text = Titles;
* //ds.Publications.Children.Add(Middle);
* Grid.SetRow(Middle, m);
* m += 1;
#endregion
* //publications location maybe
* //Creates a list of PubMed source related to the query
*
* }*/
};
_Publist = _progressBarWrapper.execute <String, PubList>(_GetPublications, _myRegDS.BasicInfo.DescriptionName, callback);
#endregion
SurfaceWindow1.addData(sender, ds);
};
_dataSheet = _progressBarWrapper.execute <String, RegDataSheet>(_getRegDataSheet, partName.Text, _getRegDataSheetCallback);
}
}
//Generates permutations of L1 modules using selected Parts
private void permMaker_Click(object sender, RoutedEventArgs e)
{
permMaker.IsEnabled = false;
List <Part> selectedPromList = new List <Part>();
List <Part> selectedRBSList = new List <Part>();
List <Part> selectedCDSList = new List <Part>();
List <Part> selectedTermList = new List <Part>();
//if the background is a different color than the border, then part is selected and should be added to selected part list
foreach (Part p in sw1.L1.L1_prom.Items)
{
if (p.BorderBrush == selected)
{
selectedPromList.Add(p);
}
}
foreach (Part r in sw1.L1.L1_rbs.Items)
{
if (r.BorderBrush == selected)
{
selectedRBSList.Add(r);
}
}
foreach (Part c in sw1.L1.L1_cds.Items)
{
if (c.BorderBrush == selected)
{
selectedCDSList.Add(c);
}
}
foreach (Part t in sw1.L1.L1_term.Items)
{
if (t.BorderBrush == selected)
{
selectedTermList.Add(t);
}
}
if (selectedPromList.Count != 0 && selectedRBSList.Count != 0 && selectedCDSList.Count != 0 && selectedTermList.Count != 0)
{
//permutations are cleared and regenerated everytime
sw1.L1.L1_permTab.Items.Clear();
foreach (Part p in selectedPromList)
{
foreach (Part r in selectedRBSList)
{
foreach (Part c in selectedCDSList)
{
foreach (Part t in selectedTermList)
{
//L1Module L = new L1Module(p, r, c, t);//////////////////////////////////////////////////
L1Module L = new L1Module();
L.L1Prom.copyPartInfoFrom(p);
L.L1RBS.copyPartInfoFrom(r);
L.L1CDS.copyPartInfoFrom(c);
L.L1Term.copyPartInfoFrom(t);
sw1.L1.L1_permTab.Items.Add(L);
L.Center = SurfaceWindow1.SetPosition(L);
//generate Level1 modules and then add to the list called Level1module List.
}
}
}
}
}
permMaker.IsEnabled = true;
}
//Detects L1module drop target and copies its data into appropriate placeholder
//Checks if module is full; if so, auto-generate new template and enable dragging on full module
private void PartInL1()
{
//try
//{
Point pt = SurfaceWindow1.transformCoords(this, sw1.L1.L1_manTab);
VisualTreeHelper.HitTest(sw1.L1.L1_manTab, null, new HitTestResultCallback(TargetL1MCallback), new PointHitTestParameters(pt));
if (targetL1M != null)
{
Part L1manclone = clone();
L1manclone.IsManipulationEnabled = false;
L1manclone.targetL1M = targetL1M;
if (_type == "prom")
{
targetL1M.L1Prom.copyPartInfoFrom(this);
}
else if (_type == "rbs")
{
targetL1M.L1RBS.copyPartInfoFrom(this);
}
else if (_type == "cds")
{
targetL1M.L1CDS.copyPartInfoFrom(this);
}
else if (_type == "term")
{
targetL1M.L1Term.copyPartInfoFrom(this);
}
//Console.WriteLine("Target detected!");
//Check to see if L1M is full and new template needed
Boolean isFull = true;
foreach (UIElement elem in targetL1M.L1Grid.Children)
{
if (elem.GetType() == typeof(Part))
{
Part p = (Part)elem;
if (p.Opacity < 1)
{
isFull = false;
break;
}
}
}
if (isFull)
{
sw1.L1.addL1Module();
targetL1M.IsManipulationEnabled = true;
targetL1M.Template.Visibility = System.Windows.Visibility.Hidden;
targetL1M.L1ElementMenu.ActivationMode = ElementMenuActivationMode.AlwaysActive;
}
}
else
{ //Dumped; check if delete from palette, too
//Console.WriteLine("Missed!");
sw1.swipeToDelete(this);
}
//}
//catch (Exception exc) { Console.WriteLine("PartInL1 \n" + exc); }
}
private void item_Selected(Object sender, RoutedEventArgs e)
{
try
{
SurfaceListBoxItem i = sender as SurfaceListBoxItem;
//abs = new PubAbstract(result.Links.ElementAt(ds.Publictions.Items.IndexOf(i)), result.getAuthors());
ScatterViewItem absBox = new ScatterViewItem();
absBox.CanRotate = false;
absBox.CanScale = false;
TextBlock abstext = new TextBlock();
abstext.Text = i.Tag as string;
SurfaceWindow1.addData(sender, absBox);
absBox.Content = abstext;
//absBox.absgrid.Children.Add(abstext);
absBox.Background = Brushes.SteelBlue;
abstext.Background = Brushes.White;
abstext.Margin = new Thickness(10);
absBox.Width = 800;
absBox.MinHeight = 600;
abstext.Width = 780;
abstext.MinHeight = 580;
absBox.ContainerManipulationCompleted += new ContainerManipulationCompletedEventHandler(absBox_ContainerManipulationCompleted);
/*TextBlock Title = new TextBlock();
* Title.Text = i.Content as string;
* absBox.absgrid.Children.Add(Title);
* Grid.SetRow(Title, 0);
* Grid.SetColumn(Title, 1);
*
* TextBlock Authors = new TextBlock();
* Authors.Text = result.Authors.ElementAt(ds.Publictions.Items.IndexOf(i));
* absBox.absgrid.Children.Add(Title);
* Grid.SetRow(Authors, 1);
* Grid.SetColumn(Authors, 1);
*
* TextBlock Journal = new TextBlock();
* Journal.Text = abs.getJournal();
* absBox.absgrid.Children.Add(Journal);
* Grid.SetRow(Journal, 2);
* Grid.SetColumn(Journal, 1);
*
*
* ds.Publictions.Items.IndexOf(i);
*
* /*ScatterViewItem abstractbox = new ScatterViewItem();
* TextBlock abstext = new TextBlock();
* SurfaceListBoxItem i = sender as SurfaceListBoxItem;
* abstext.Text = i.Tag as string;
* abstractbox.Content = abstext;*/
sw1.L0.L0_SV.Items.Add(absBox);
}
catch (Exception exc) { Console.WriteLine(exc); }
}
private void hideProgressBar()
{
SurfaceWindow1.getProgressIndicator(this).Visibility = Visibility.Collapsed;
}
private void showProgressBar()
{
SurfaceWindow1.getProgressIndicator(this).Visibility = Visibility.Visible;
}
